Interleukin-1 (IL-1)-induced TAK1-dependent Versus MEKK3-dependent NFκB Activation Pathways Bifurcate at IL-1 Receptor-associated Kinase Modification
Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is phosphorylated after it is recruited to the receptor, subsequently ubiquitinated, and eventually degraded upon IL-1 stimulation. Although a point mutation changing lysine 134 to arginine (K134R) in IRAK abolished IL-1-induced IRAK ubiquitination and degradation, mutations of serines and threonines adjacent to lysine 134 to alanines ((S/T)A (131–144)) reduced IL-1-induced IRAK phosphorylation and abolished IRAK ubiquitination. Through the study of these IRAK modification mutants, we uncovered two parallel IL-1-mediated signaling pathways for NFκB activation, TAK1-dependent and MEKK3-dependent, respectively. These two pathways bifurcate at the level of IRAK modification. The TAK1-dependent pathway leads to IKKα/β phosphorylation and IKKβ activation, resulting in classical NFκB activation through IκBα phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway involves IKKγ phosphorylation and IKKα activation, resulting in NFκB activation through IκBα phosphorylation and subsequent dissociation from NFκB but without IκBα degradation. These results provide significant insight to our further understanding of NFκB activation pathways. Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is phosphorylated after it is recruited to the receptor, subsequently ubiquitinated, and eventually degraded upon IL-1 stimulation. Although a point mutation changing lysine 134 to arginine (K134R) in IRAK abolished IL-1-induced IRAK ubiquitination and degradation, mutations of serines and threonines adjacent to lysine 134 to alanines ((S/T)A (131–144)) reduced IL-1-induced IRAK phosphorylation and abolished IRAK ubiquitination. Through the study of these IRAK modification mutants, we uncovered two parallel IL-1-mediated signaling pathways for NFκB activation, TAK1-dependent and MEKK3-dependent, respectively. These two pathways bifurcate at the level of IRAK modification. The TAK1-dependent pathway leads to IKKα/β phosphorylation and IKKβ activation, resulting in classical NFκB activation through IκBα phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway involves IKKγ phosphorylation and IKKα activation, resulting in NFκB activation through IκBα phosphorylation and subsequent dissociation from NFκB but without IκBα degradation. These results provide significant insight to our further understanding of NFκB activation pathways. IL-1 2The abbreviations used are: IL-1, interleukin-1; IRAK, IL-1 receptor-associated kinase; IKK, IκB kinase; MEF, mouse embryonic fibroblast; GST, glutathione S-transferase; DD, death domain; UD, undetermined domain; KD, kinase domain; E3, ubiquitin-protein isopeptide ligase; MAPK, mitogen-activated protein kinase; JNK, c-Jun N-terminal kinase.2The abbreviations used are: IL-1, interleukin-1; IRAK, IL-1 receptor-associated kinase; IKK, IκB kinase; MEF, mouse embryonic fibroblast; GST, glutathione S-transferase; DD, death domain; UD, undetermined domain; KD, kinase domain; E3, ubiquitin-protein isopeptide ligase; MAPK, mitogen-activated protein kinase; JNK, c-Jun N-terminal kinase.-mediated signaling begins when IL-1 binds to the receptor complex, consisting of the IL-1 receptor (IL-1R) and its accessory protein (IL-1RAcp) (1Greenfeder S.A. Nunes P. Kwee L. Labow M. Chizzonite R.A. Ju G. J. Biol. Chem. 1995; 270: 13757-13765Abstract Full Text Full Text PDF PubMed Scopus (557) Google Scholar, 2Huang J. Gao X. Li S. Cao Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12829-12832Crossref PubMed Scopus (194) Google Scholar, 3Korherr C. Hofmeister R. Wesche H. Falk W. Eur. J. Immunol. 1997; 27: 262-267Crossref PubMed Scopus (153) Google Scholar) (Fig. 1). The cytosolic protein MyD88 (4Adachi O. Kawai T. Takeda K. Matsumoto M. Tsutsui H. Sakagami M. Nakanishi K. Akira S. Immunity. 1998; 9: 143-150Abstract Full Text Full Text PDF PubMed Scopus (1704) Google Scholar, 5Wesche H. Henzel W.J. Shillinglaw W. Li S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (915) Google Scholar, 6Lord K.A. Hoffman-Liebermann B. Liebermann D.A. Oncogene. 1990; 5: 1095-1097PubMed Google Scholar) is then recruited to the receptor complex. MyD88 functions as an adapter, recruiting IRAK4 (IL-1 receptor-associated kinase 4) and IRAK to the IL-1 receptor complex, where IRAK is hyperphosphorylated (7Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (768) Google Scholar, 8Li S. Strelow A. Fontana E.J. Wesche H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5567-5572Crossref PubMed Scopus (534) Google Scholar, 9Picard C. Puel A. Bonnet M. Ku C.L. Bustamante J. Yang K. Soudais C. Dupuis S. Feinberg J. Fieschi C. Elbim C. Hitchcock R. Lammas D. Davies G. Al Ghonaium A. Al Rayes H. Al Jumaah S. Al Hajjar S. Al Mohsen I.Z. Frayha H.H. Rucker R. Hawn T.R. Aderem A. Tufenkeji H. Haraguchi S. Day N.K. Good R.A. Gougerot-Pocidalo M.A. Ozinsky A. Casanova J.L. Science. 2003; 299: 2076-2079Crossref PubMed Scopus (773) Google Scholar, 10Suzuki N. Suzuki S. Duncan G.S. Millar D.G. Wada T. Mirtsos C. Takada H. Wakeham A. Itie A. Li S. Penninger J.M. Wesche H. Ohashi P.S. Mak T.W. Yeh W.C. Nature. 2002; 416: 750-756Crossref PubMed Scopus (656) Google Scholar) (Fig. 1). The phosphorylation of IRAK is likely to play an important role in IL-1-mediated signaling, although the kinase activity of IRAK is dispensable for its function (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 12Qin J. Jiang Z. Qian Y. Casanova J.L. Li X. J. Biol. Chem. 2004; 279: 26748-26753Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 13Lye E. Mirtsos C. Suzuki N. Suzuki S. Yeh W.C. J. Biol. Chem. 2004; 279: 40653-40658Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). TRAF6 is also part of the IL-1 receptor complex, recruited through its interaction with the phosphorylated IRAK (14Cao Z. Xiong J. Takeuchi M. Kurama T. Goeddel D.V. Nature. 1996; 383: 443-446Crossref PubMed Scopus (1117) Google Scholar) (designated as Complex I in Fig. 1). TAK1 (transforming growth factor-β-activated kinase 1), a member of the MAPK kinase kinase family, and the proteins that bind to it, TAB1, TAB2, and TAB3, have been implicated in IL-1 signaling (15Jiang Z. Ninomiya-Tsuji J. Qian Y. Matsumoto K. Li X. Mol. Cell. Biol. 2002; 22: 7158-7167Crossref PubMed Scopus (238) Google Scholar, 16Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1014) Google Scholar, 17Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (484) Google Scholar, 18Jin G. Klika A. Callahan M. Faga B. Danzig J. Jiang Z. Li X. Stark G.R. Harrington J. Sherf B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2028-2033Crossref PubMed Scopus (68) Google Scholar, 19Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (691) Google Scholar, 20Ishitani T. Takaesu G. Ninomiya-Tsuji J. Shibuya H. Gaynor R.B. Matsumoto K. EMBO J. 2003; 22: 6277-6288Crossref PubMed Scopus (218) Google Scholar, 21Cheung P.C. Nebreda A.R. Cohen P. Biochem. J. 2004; 378: 27-34Crossref PubMed Scopus (132) Google Scholar, 22Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar, 23Deng L. Wang C. Spencer E. Yang L. Braun A. You J. Slaughter C. Pickart C. Chen Z.J. Cell. 2000; 103: 351-361Abstract Full Text Full Text PDF PubMed Scopus (1496) Google Scholar, 24Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1621) Google Scholar). IL-1 failed to activate TAK1 in IRAK-deficient cells, indicating that IRAK is required for the activation of TAK1. IRAK mediates the activation of TAK1 by bringing TRAF6 to form a complex with TAK1-TAB1-TAB2-TAB3, which are shown to be preassociated on the membrane. This membrane-bound IRAK-TRAF6-TAK1-TAB1-TAB2-TAB3 complex has been designated as Complex II (Fig. 1). Through an unknown mechanism, TRAF6-TAK1-TAB1-TAB2-TAB3 (Fig. 1, Complex II) is dissociated from IRAK and translocated from the membrane to the cytosol, where TAK1 is activated. Chen and co-workers (23Deng L. Wang C. Spencer E. Yang L. Braun A. You J. Slaughter C. Pickart C. Chen Z.J. Cell. 2000; 103: 351-361Abstract Full Text Full Text PDF PubMed Scopus (1496) Google Scholar, 24Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1621) Google Scholar) showed that protein ubiquitination plays an important role in TRAF6-mediated TAK1 and IKK activation. TRAF6, a Ring domain protein, has been shown recently to function as a ubiquitin protein ligase E3, and TRAF6 itself is the target of ubiquitination, which has been shown to activate TAK1 through an unknown mechanism. Once activated, TAK1 leads to the phosphorylation of IKKβ and MKK6, resulting in the activation of both the JNK and NFκB signaling pathways. In addition to TAK1, MEKK2 and MEKK3 have also been implicated in the activation of IKK and MAPK, leading to the activation of NFκB and JNK (25Yujiri T. Ware M. Widmann C. Oyer R. Russell D. Chan E. Zaitsu Y. Clarke P. Tyler K. Oka Y. Fanger G.R. Henson P. Johnson G.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7272-7277Crossref PubMed Scopus (207) Google Scholar, 26Yang J. Lin Y. Guo Z. Cheng J. Huang J. Deng L. Liao W. Chen Z. Liu Z. Su B. Nat. Immun. 2001; 2: 620-624Crossref Scopus (351) Google Scholar, 27Xiao C. Shim J.H. Kluppel M. Zhang S.S. Dong C. Flavell R.A. Fu X.Y. Wrana J.L. Hogan B.L. Ghosh S. Genes Dev. 2003; 17: 2933-2949Crossref PubMed Scopus (77) Google Scholar, 28Huang Q. Yang J. Lin Y. Walker C. Cheng J. Liu Z.G. Su B. Nat. Immun. 2004; 5: 98-103Crossref Scopus (228) Google Scholar). The detailed signaling mechanism is not clear. Recently genetic studies have provided further evidence for an essential role of TAK1 in IL-1 signaling. Two groups (29Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immun. 2005; 6: 1087-1095Crossref Scopus (746) Google Scholar, 30Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (584) Google Scholar) independently reported that TAK1 deficiency results in defects in IL-1 signaling. Intriguingly, although IL-1-induced JNK activation was completely abolished, NFκB activation was only partially impaired in TAK1-deficient cells, implicating an additional NFκB activation mechanism for the IL-1 pathway. Here, through the study of IRAK modification, we uncovered two parallel IL-1-mediated signaling pathways for NFκB activation, TAK1-dependent and MEKK3-dependent pathways, respectively (Fig. 1). These two pathways bifurcate at the level of IRAK modification. The TAK1-dependent pathway leads to IKKα/β phosphorylation and IKKβ activation, resulting in classical NFκB activation through IκBα phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway involves IKKγ phosphorylation and IKKα activation, resulting in NFκB activation through IκBα phosphorylation and subsequent dissociation from NFκB but without IκBα degradation. These results provide significant insight to our further understanding of NFκB activation pathways. Biological Reagents and Cell Culture—Recombinant human IL-1 was provided by the National Cancer Institute. Antibodies against phosphorylated IκBα (Ser32/Ser36), JNK, IKKα/β (Ser176/180), IKKγ (Ser376), and total IκBα, JNK, IKKα, and IKKβ were purchased from Cell Signaling. Antibody to FLAG (anti-FLAG) was purchased from Sigma. Antibodies against ubiquitin, NFκB, IRAK, and TAK1 were from Santa Cruz Biotechnology. 293 and IRAK-deficient cells (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar), TAK1-deficient MEFs (29Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immun. 2005; 6: 1087-1095Crossref Scopus (746) Google Scholar), MEKK3-deficient MEFs (26Yang J. Lin Y. Guo Z. Cheng J. Huang J. Deng L. Liao W. Chen Z. Liu Z. Su B. Nat. Immun. 2001; 2: 620-624Crossref Scopus (351) Google Scholar), and IKKα (31Hu Y. Baud V. Delhase M. Zhang P. Deerinck T. Ellisman M. Johnson R. Karin M. Science. 1999; 284: 316-320Crossref PubMed Scopus (707) Google Scholar), IKKβ (32Li Z.W. Chu W. Hu Y. Delhase M. Deerinck T. Ellisman M. Johnson R. Karin M. J. Exp. Med. 1999; 189: 1839-1845Crossref PubMed Scopus (815) Google Scholar, 33Li Z.W. Omori S.A. Labuda T. Karin M. Rickert R.C. J. Immunol. 2003; 170: 4630-4637Crossref PubMed Scopus (142) Google Scholar), and IKKα/β-deficient MEFs (34Li Q. Estepa G. Memet S. Israel A. Verma I.M. Genes Dev. 2000; 14: 1729-1733PubMed Google Scholar) were maintained in Dulbecco's modified Eagle's medium, supplemented with 10% fetal bovine serum, penicillin G (100 μg/ml), and streptomycin (100 μg/ml). Recombinant Plasmids and Transfection—IRAK phosphorylation and ubiquitination mutants were generated by site-directed mutagenesis and cloned into FLAG-tagged pCMV vector (Sigma). Oligonucleotides used for making the phosphorylation mutants were as follows: AGCCGCAGCCGCCGCCTTCCTCGCCCCAGCTTTTCCAGGCGCCCAGACCCATT and GGGCGCCTGGAAAAGCTGGGGCGAGGAAGGCGGCGGCTGCGGCTGGCAACTT. Oligonucleotides used for making the ubiquitination mutants were as follows: GCCCCCGGAGGTTGCCATCCTCAGCCTCC and GGATGGCAACCTCCGGGGGCTCCAGGCCTC. Transfection of the indicated plasmids by FuGENE 6 transfection reagents was done as recommended by the manufacturer (Roche Diagnostics). Coimmunoprecipitation and Immunoblotting—Cell were harvested and lysed in a Triton-containing lysis buffer (0.5% Triton X-100, 20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 10 mm NaF, 2 mm dithiothreitol, 1 mm sodium orthovanadate, 2 mm EGTA, 1 mm phenylmethylsulfonyl fluoride, and complete protease inhibitor mixture from Roche Diagnostics). Cell extracts were incubated with 1 μg of antibody or preimmune serum (negative control) for 2 h followed by a 2-h incubation with 20 μl of protein A-Sepharose beads (prewashed and resuspended in phosphate-buffered saline at a 1:1 ratio). After incubation, the beads were washed three or four times with lysis buffer and resuspended in 20 μl of lysis buffer. For immunoblotting, the immunoprecipitates were separated by 10% SDS-PAGE, transferred to Immobilon-P membranes (Millipore), and analyzed by immunoblotting. Kinase Assays—Cell lysates were immunoprecipitated with anti-IKKα/β (for IκB kinase assay) or anti-TAK1 (for TAK1 kinase assay) and collected on protein A-Sepharose beads. Kinase reactions were performed in 50 μl of buffer containing 20 mm HEPES (pH 7.0), 20 mm MgCl2, 1 mm ATP, 10 mCi of [γ-32P]ATP at 30 °C for 30 min. The substrate for IκB kinase assay was 2 μg of glutathione S-transferase (GST)-IκB, residues (1–54 amino acids) (J. DiDonato, Cleveland Clinic Foundation, Cleveland, OH), whereas the substrate for TAK1 kinase assay was 2 μg of His-MKK6. Samples were analyzed by 10% SDS-PAGE, followed by autoradiography. For IRAK kinase assay, cell lysates were immunoprecipitated with anti-IRAK antibody. Purified recombinant IRAK4 (Upstate) was added to the immunoprecipitates, followed by kinase assay as instructed by the manufacturer. TAK1 Inhibitor Treatment—The TAK1 inhibitor (5Z-7-oxozeaenol) was purchased from AnalytiCon Discovery GmbH (catalog number NP-009245). Stock solutions were made up at 10 mm in Me2SO. To block the TAK1 activity, wild type, MEKK3–/–, or IKKα–/– MEFs were pretreated with 600 nm of TAK1 inhibitor for 3 h prior to IL-1β treatment. Virus Infections—MEFs were infected with adenovirus (provided by Frank Mercurio at Celgene (San Diego)) expressing either green fluorescent protein (control), IKKβ, or kinase-inactive IKKβ. The titer of each adenovirus stock used for infection was as follows: green fluorescent protein = 3 × 108, IKKβ = 5 × 108, and kinase-inactive IKKβ = 1 × 109 virus particles/ml. After 18 h, the infected cells were stimulated with IL-1 or were unstimulated. The production of retrovirus and infection has been described previously (35Li X. Commane M. Nie H. Hua X. Chatterjee-Kishore M. Wald D. Haag M. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10489-10493Crossref PubMed Scopus (141) Google Scholar). Identification of IRAK Phosphorylation and Ubiquitination Sites—IRAK is a multidomain protein (7Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (768) Google Scholar, 11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 15Jiang Z. Ninomiya-Tsuji J. Qian Y. Matsumoto K. Li X. Mol. Cell. Biol. 2002; 22: 7158-7167Crossref PubMed Scopus (238) Google Scholar, 36Kollewe C. Mackensen A.C. Neumann D. Knop J. Cao P. Li S. Wesche H. Martin M.U. J. Biol. Chem. 2004; 279: 5227-5236Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 37Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (143) Google Scholar, 38Ye H. Arron J.R. Lamothe B. Cirilli M. Kobayashi T. Shevde N.K. Segal D. Dzivenu O.K. Vologodskaia M. Yim M. Du K. Singh S. Pike J.W. Darnay B.G. Choi Y. Wu H. Nature. 2002; 418: 443-447Crossref PubMed Scopus (527) Google Scholar) (Fig. 2A) containing an N-terminal death domain (DD, residues 1–103), followed by a proline/serine/threonine-rich region (UD, also known as P-ST region, residues 104–198), a kinase domain (KD, residues 199–522), and a two-part C-terminal domain containing TRAF6-binding sites (residues 523–618 for C1 and residues 619–712 for C2). IRAK-deficient cells have been used effectively to study the function of IRAK in IL-1-dependent signaling (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 15Jiang Z. Ninomiya-Tsuji J. Qian Y. Matsumoto K. Li X. Mol. Cell. Biol. 2002; 22: 7158-7167Crossref PubMed Scopus (238) Google Scholar, 37Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (143) Google Scholar, 39Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). NFκB and JNK activation were greatly reduced in IL-1-treated IRAK-deficient cells, but these responses are restored in IRAK-deficient cells transfected with IRAK, indicating that IRAK is required for both. Analysis of IRAK deletion mutants showed that the truncated IRAK protein DD + UD + C1 (containing the DD, UD, and C1 domains) is sufficient to restore IL-1-induced NFκB and JNK activation in IRAK-deficient cells. Like the full-length IRAK, DD + UD + C1 is phosphorylated after it is recruited to the receptor, subsequently ubiquitinated, and eventually degraded upon IL-1 stimulation (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 15Jiang Z. Ninomiya-Tsuji J. Qian Y. Matsumoto K. Li X. Mol. Cell. Biol. 2002; 22: 7158-7167Crossref PubMed Scopus (238) Google Scholar, 37Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (143) Google Scholar, 37Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (143) Google Scholar, 39Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). Treatment with calf intestinal phosphatase leads to loss of several IL-1-induced shifted IRAK bands, confirming that they are phosphorylated forms (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar). IL-1-induced IRAK ubiquitination was confirmed by immunoprecipitation with anti-IRAK antibody followed by Western analysis with anti-ubiquitin antibody (39Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). To investigate the role of IRAK modification in IL-1 signaling, much effort has been devoted to map IRAK phosphorylation and ubiquitination sites. Because protein ubiquitination occurs on lysine residues, we mutated all three lysines in DD + UD + C1 (Fig. 2A, lysines at 32, 134, and 179) individually and in combinations. These mutants were then transfected into IRAK-deficient cells and tested for their modification and degradation in response to IL-1 stimulation. Although DD + UD + C1 was phosphorylated, ubiquitinated, and degraded (degradation is complete 6 h after stimulation (data not shown)), a point mutation changing lysine 134 to arginine completely abolished IL-1-induced IRAK ubiquitination and degradation (Fig. 2, B and C). Importantly, the K134R mutant was still phosphorylated upon IL-1 stimulation (Fig. 2D). We have shown previously that the kinase-inactive mutant of IRAK is still phosphorylated, ubiquitinated, and degraded upon IL-1 stimulation (11Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar). We mutated lysine 134 to arginine in the kinase-inactive full-length IRAK in order to mimic DD + UD + C1 (which does not contain the kinase domain), eliminating modification initiated by IRAK autophosphorylation. The full-length ubiquitination mutant (IRAK1 KD ubmt) was modified upon IL-1 stimulation but with greatly reduced degradation as compared with the full-length IRAK (IRAK1 KD mt) (Fig. 2E). Treatment with calf intestinal phosphatase leads to loss of IL-1-induced shifted IRAK bands of the full-length ubiquitination mutant (IRAK1 KD ubmt), confirming that they are phosphorylated forms (Fig. 2F). These results suggest that the full-length ubiquitination mutant (IRAK1 KD ubmt) is probably still phosphorylated but deficient in ubiquitination in response to IL-1 stimulation, indicating that lysine 134 is an important site for IL-1-induced IRAK ubiquitination and subsequent degradation. Protein ubiquitination occurs on conserved lysine residues near the phosphoacceptor serines or threonines, and protein phosphorylation precedes ubiquitination (40Ciechanover A. Gonen H. Bercovich B. Cohen S. Fajerman I. Israel A. Mercurio F. Kahana C. Schwartz A.L. Iwai K. Orian A. Biochimie (Paris). 2001; 83: 341-349Crossref PubMed Scopus (57) Google Scholar, 41DiDonato J. Mercurio F. Rosette C. Wu-Li J. SuYang H. Ghosh S. Karin M. Mol. Cell. Biol. 1996; 16: 1295-1304Crossref PubMed Google Scholar). Previous studies indeed suggested that phosphorylation of IRAK is probably required for its ubiquitination and degradation (42Yamin T.T. Miller D.K. J. Biol. Chem. 1997; 272: 21540-21547Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar). To identify the phosphorylation sites, we mutated serines and threonines adjacent to K134R to alanines ((S/T)A (131–144), Ser131, Ser137, Ser138, Ser140, Thr141 and Ser144) in the truncated form of IRAK (DD + UD + C1) (Fig. 2, B and D). The mutation of these sites reduced IL-1-induced IRAK phosphorylation (Fig. 2D) and abolished IRAK ubiquitination and degradation (Fig. 2B). We then mutated the same sites in the kinase-inactive full-length IRAK. The full-length phosphorylation mutant (IRAK1 KD pmt) altered the modification pattern of the full-length IRAK and greatly reduced its ubiquitination and degradation in response to IL-1 stimulation (Fig. 2G). The Impact of IRAK Modification on IL-1-induced NFκB and JNK Activation—To investigate the role of IRAK modification in IL-1 signaling, the above IRAK mutants defective in IRAK modification were examined for their ability to restore IL-1-induced NFκB and JNK activation in IRAK-deficient cells. For all of the following experiments, pools of IRAK-deficient cells stably transfected with IRAK modification mutants were used and the expression levels of the IRAK mutants were shown in Fig. 3A. Both ubiquitination (K134R) and phosphorylation ((S/T)A (131–144)) mutants in the truncated form (DD + UD + C1) or the full-length IRAK fully restored IL-1-induced NFκB activation in IRAK-deficient cells, as measured by NFκB DNA binding activity (Fig. 3B), IκBα phosphorylation (Fig. 3C), and NFκB-dependent luciferase reporter assay (data not shown). However, IL-1-induced IκBα degradation was greatly reduced in IRAK-deficient cells transfected with these IRAK modification mutants (Fig. 3C), implicating a specific role of IRAK modification in the NFκB activation pathway. Because IκBα expression is induced upon IL-1 stimulation, we used the protein synthesis inhibitor cycloheximide to inhibit the new synthesis of IκBα so that IL-1-induced IκBα degradation can be more easily detected. We confirmed the lack of IL-1-induced IκBα degradation in the presence of protein synthesis inhibition in IRAK-deficient cells transfected with the IRAK modification mutants (Fig. 3D). Furthermore, these IRAK mutants only partially restored IL-1-induced JNK activation in IRAK-deficient cells, indicating the importance of IRAK modification in IL-1 signaling (Fig. 3E).FIGURE 3The impact of mutation in IRAK modification on IL-1-induced NFκB and JNK activation. A, Western analysis. Cell lysates from wild type 293, IRAK-deficient (IRAK-null), or IRAK-deficient cells stably transfected with truncated IRAK constructs (DD + UD + C1, (S/T)A (131–144) and K134R) and full-length kinase-inactive IRAK constructs (IRAK KD, IRAK KDubmt, IRAK KD pmt) were analyzed by Western blot with anti-IRAK and anti-actin antibodies. B, gel shift assay. Wild type 293, IRAK-deficient (IRAK-null), and IRAK-deficient cells stably transfected with truncated IRAK constructs (DD + UD + C1, (S/T)A (131–144), and K134R) and IRAK kinase-inactive full-length constructs (IRAK KD mt, IRAK KD ubmt, and IRAK KD pmt) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed by electrophoretic mobility shift assay with a NFκB-specific probe. C–E, Western analyses. 293 wild type cells, IRAK-deficient cells, and IRAK-deficient cells stably transfected with IRAK modification mutants in the truncated IRAK (DD + UD + C1, (S/T)A (131–144) and K134R) or kinase-inactive full length (IRAK KD mt, IRAK KD pmt, and IRAK KD ubmt) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed by Western blots with anti-pIκBα, anti-IκBα, anti-pJNK, anti-JNK, or anti-actin. D, cells were pretreated with cycloheximide (CHX) (20 μg/ml) for 2 h before stimulation with IL-1. The degradation of IκBα was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples.View Large Image Figure ViewerDownload Hi-res image Download (PPT) IRAK Modification Mutants Failed to Activate TAK1—We then carefully examined the impact of these IRAK mutants on IL-1-induced intermediate signaling leading to NFκB activation. Previous studies showed that IL-1-induced TAK1 activation plays a critical role in IL-1 signaling (15Jiang Z. Ninomiya-Tsuji J. Qian Y. Matsumoto K. Li X. Mol. Cell. Biol. 2002; 22: 7158-7167Crossref PubMed Scopus (238) Google Scholar, 17Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (484) Google Scholar, 29Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immun. 2005; 6: 1087-1095Crossref Scopus (746) Google Scholar, 30Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (584) Google Scholar). As shown in Fig. 4A, whereas modified IRAK forms a complex with TAK1 upon IL-1 stimulation in wild type 293 cells and IRAK-deficient cells transfected with the truncated IRAK (DD + UD + C1), IL-1-induced interaction between IRAK and TAK1 was abolished in IRAK-deficient cells transfected with IRAK phosphorylation and ubiquitination mutants, indicating that IRAK modification is required for the interaction of IRAK with TAK1. Previous studies showed that IL-1 stimulation leads to TAK1 phosphorylation and TAK1 activation in an IRAK-dependent manner (22Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). Because the IRAK mutants failed to interact with TAK1 upon IL-1 stimulation, we suspect that these mutants have also lost the ability to activate TAK1. As shown in Fig. 4, B–D, the IRAK modification mutants indeed failed to activate the TAK1 in response to IL-1 stimulation, including TAK1 phosphorylation (Fig. 4B) and TAK1 kinase activity (Fig. 4D). IL-1-induced TAK1 phosphorylation was confirmed by treatment with calf intestinal phosphatase (Fig. 4C). These results suggest that IRAK modification is required for the interaction of IRAK with TAK1, thereby mediating the activation of TAK1. IRAK Modification Mutants Formed Complex with TRAF6 and ME
Jianhong Yao, Tae Whan Kim, Jinzhong Qin et al. 2006Article