Solution Structure of the Carboxyl-terminal LIM Domain from Quail Cysteine-rich Protein CRP2

Proteins of the cysteine-rich protein (CRP) family (CRP1, CRP2, and CRP3) are implicated in diverse processes linked to cellular differentiation and growth control. CRP proteins contain two LIM domains, each formed by two zinc-binding modules of the CCHC and CCCC type, respectively. The solution structure of the carboxyl-terminal LIM domain (LIM2) from recombinant quail CRP2 was determined by multidimensional homo- and heteronuclear magnetic resonance spectroscopy. The folding topology retains both independent zinc binding modules (CCHC and CCCC). Each module consists of two orthogonally arranged antiparallel β-sheets, and the carboxyl-terminal CCCC module is terminated by an α-helix.15N magnetic relaxation data indicate that the modules differ in terms of conformational flexibility. They pack together via a hydrophobic core region. In addition, Arg122in the CCHC module and Glu155 in the CCCC module are linked by an intermodular hydrogen bond and/or salt bridge. These residues are absolutely conserved in the CRP family of LIM proteins, and their interaction might contribute to the relative orientation of the two zinc-binding modules in CRP LIM2 domains. The global fold of quail CRP2 LIM2 is very similar to that of the carboxyl-terminal LIM domain of the related but functionally distinct CRP family member CRP1, analyzed recently. The carboxyl-terminal CCCC module is structurally related to the DNA-binding domain of the erythroid transcription factor GATA-1. In the two zinc-binding modules of quail CRP2 LIM2, flexible loop regions made up of conserved amino acid residues are located on the same side of the LIM2 domain and may cooperate in macromolecular recognition. Proteins of the cysteine-rich protein (CRP) family (CRP1, CRP2, and CRP3) are implicated in diverse processes linked to cellular differentiation and growth control. CRP proteins contain two LIM domains, each formed by two zinc-binding modules of the CCHC and CCCC type, respectively. The solution structure of the carboxyl-terminal LIM domain (LIM2) from recombinant quail CRP2 was determined by multidimensional homo- and heteronuclear magnetic resonance spectroscopy. The folding topology retains both independent zinc binding modules (CCHC and CCCC). Each module consists of two orthogonally arranged antiparallel β-sheets, and the carboxyl-terminal CCCC module is terminated by an α-helix.15N magnetic relaxation data indicate that the modules differ in terms of conformational flexibility. They pack together via a hydrophobic core region. In addition, Arg122in the CCHC module and Glu155 in the CCCC module are linked by an intermodular hydrogen bond and/or salt bridge. These residues are absolutely conserved in the CRP family of LIM proteins, and their interaction might contribute to the relative orientation of the two zinc-binding modules in CRP LIM2 domains. The global fold of quail CRP2 LIM2 is very similar to that of the carboxyl-terminal LIM domain of the related but functionally distinct CRP family member CRP1, analyzed recently. The carboxyl-terminal CCCC module is structurally related to the DNA-binding domain of the erythroid transcription factor GATA-1. In the two zinc-binding modules of quail CRP2 LIM2, flexible loop regions made up of conserved amino acid residues are located on the same side of the LIM2 domain and may cooperate in macromolecular recognition. Tetrahedral zinc-binding domains are important structural elements in a wide variety of proteins, and more than 10 different classes of such Zn(II)-binding motifs have been identified and biochemically characterized, many of them in proteins specifically interacting with nucleic acids (1Schwabe J.W.R. Klug A. Nat. Struct. Biol. 1994; 1: 345-349Google Scholar, 2Berg J.M. Shi Y. Science. 1996; 271: 1081-1085Google Scholar). The four coordinating ligands in the tetrahedral zinc-binding sites are composed of cysteine sulfur, histidine imidazole nitrogen, or, occasionally, oxygen from a glutamate or aspartate side chain. The LIM 1The abbreviations used are: LIM, specific double zinc-finger motif; LIM2, carboxyl-terminal LIM domain of cysteine-rich protein; CRP, cysteine-rich protein; CSRP, gene encoding CRP protein; CRIP, cysteine-rich intestinal protein; NOE, nuclear Overhauser effect; NOESY, nuclear Overhauser effect spectroscopy; TOCSY, total correlation spectroscopy; HSQC, heteronuclear single-quantum correlation spectroscopy; HMQC, heteronuclear multiple-quantum correlation spectroscopy; T 1, longitudinal relaxation time; T 2, transverse relaxation time; r.m.s., root mean square. motif defines one class of zinc-binding domain and was originally recognized in, and named after, the protein products of the lin-11, isl-1, andmec-3 genes (3Freyd G. Kim S.K. Horvitz H.R. Nature. 1990; 344: 876-879Google Scholar, 4Karlsson O. Thor S. Norberg T. Ohlsson H. Edlund T. Nature. 1990; 344: 879-882Google Scholar). The gene products of lin-11and mec-3 transcriptionally regulate genes involved in cell fate determination and differentiation in Caenorhabditis elegans, and the isl-1 gene encodes a rat insulin I gene enhancer-binding protein. LIM domains are found in 1–5 copies in many different proteins of diverse functions, either alone or associated with distinct domains of defined function like homeodomains or protein kinase domains (5Sanchez-Garcia I. Rabbitts T.H. Trends Genet. 1994; 10: 315-320Google Scholar, 6Dawid I.B. Toyama R. Taira M. C. R. Acad. Sci. ( Paris ). 1995; 318: 295-306Google Scholar, 7Taira M. Evrard J.-L. Steinmetz A. Dawid I.B. Trends Genet. 1995; 11: 431-432Google Scholar). The LIM motif is basically composed of two zinc finger structures separated by a 2-amino acid spacer and conforms to the consensus sequence CX 2CX 16–23HX 2CX 2CX 2CX 16–21CX 2(C/H/D) (5Sanchez-Garcia I. Rabbitts T.H. Trends Genet. 1994; 10: 315-320Google Scholar, 6Dawid I.B. Toyama R. Taira M. C. R. Acad. Sci. ( Paris ). 1995; 318: 295-306Google Scholar, 7Taira M. Evrard J.-L. Steinmetz A. Dawid I.B. Trends Genet. 1995; 11: 431-432Google Scholar). Spectroscopic studies of LIM domains derived from different LIM proteins revealed that each double finger LIM domain specifically binds two zinc ions (8Michelsen J.W. Schmeichel K.L. Beckerle M.C. Winge D.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4404-4408Google Scholar, 9Michelsen J.W. Sewell A.K. Louis H.A. Olsen J.I. Davis D.R. Winge D.R. Beckerle M.C. J. Biol. Chem. 1994; 269: 11108-11113Google Scholar, 10Kosa J.L. Michelsen J.W. Louis H.A. Olsen J.I. Davis D.R. Beckerle M.C. Winge D.R. Biochemistry. 1994; 33: 468-477Google Scholar, 11Archer V.E.V. Breton J. Sanchez-Garcia I. Osada H. Forster A. Thomson A.J. Rabbitts T.H. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 316-320Google Scholar). A distinct family of genes, the CSRPgenes, encode a specific class of LIM proteins, termed cysteine-rich proteins (CRPs) (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar). CRP proteins contain 192–194 amino acid residues and exhibit two LIM domains, termed LIM1 (amino-terminal) and LIM2 (carboxyl-terminal). CRP LIM1 and LIM2 domains invariably conform to the 52-amino acid consensus sequence CX 2CX 17HX 2 CX 2CX 2CX 17CX 2C and are separated from each other by 56–59 amino acids (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar). Each CRP LIM motif contains two tetrahedral Zn(II)-coordinating modules, an amino-terminal S3N1 site of the CCHC type, and a carboxyl-terminal S4 site of the CCCC type (8Michelsen J.W. Schmeichel K.L. Beckerle M.C. Winge D.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4404-4408Google Scholar, 9Michelsen J.W. Sewell A.K. Louis H.A. Olsen J.I. Davis D.R. Winge D.R. Beckerle M.C. J. Biol. Chem. 1994; 269: 11108-11113Google Scholar, 10Kosa J.L. Michelsen J.W. Louis H.A. Olsen J.I. Davis D.R. Beckerle M.C. Winge D.R. Biochemistry. 1994; 33: 468-477Google Scholar). The expression patterns of CSRP genes and the structural properties of their CRP protein products suggest that these genes may have important roles in the regulation of cell differentiation and proliferation. The CSRP1 gene was shown to have properties typical for a primary response gene (13Liebhaber S.A. Emery J.G. Urbanek M. Wang X. Cooke N.E. Nucleic Acids Res. 1990; 18: 3871-3879Google Scholar, 14Wang X. Lee G. Liebhaber S.A. Cooke N.E. J. Biol. Chem. 1992; 267: 9176-9184Google Scholar) and its protein product, CRP1, was found to be associated with specific components of the cytoskeleton (15Sadler I. Crawford A.W. Michelsen J.W. Beckerle M.C. J. Cell Biol. 1992; 119: 1573-1587Google Scholar, 16Crawford A.W. Pino J.D. Beckerle M.C. J. Cell Biol. 1994; 124: 117-127Google Scholar). The CSRP2 gene encoding the CRP2 protein was discovered on the basis of its strong suppression in avian fibroblasts transformed by retroviral oncogenes or chemical carcinogens (17Weiskirchen R. Bister K. Oncogene. 1993; 8: 2317-2324Google Scholar). The suppression of CSRP2 gene expression directly correlates with the transformed phenotype of avian fibroblasts in a conditional transformation system (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar) and with the proliferative state of rat arterial smooth muscle cells after mitogenic stimulation (18Jain M.K. Fujita K.P. Hsieh C.-M. Endege W.O. Sibinga N.E.S. Yet S.-F. Kashiki S. Lee W.-S. Perrella M.A. Haber E. Lee M.-E. J. Biol. Chem. 1996; 271: 10194-10199Google Scholar). The CSRP3 gene was isolated on the basis of its induced expression during rat skeletal muscle differentiation, and its protein product, CRP3 (or MLP for muscle LIM protein), was shown to be a positive regulator of myogenesis (19Arber S. Halder G. Caroni P. Cell. 1994; 79: 221-231Google Scholar). In pairwise alignments, the avian homologs of the three members of the CRP family of LIM proteins share 63–76% identical residues in their amino acid sequences and hence represent related but distinct members of this protein family (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar). The precise biochemical function of LIM domains in general and of CRP proteins in particular has not been defined yet. The solution structure of the carboxyl-terminal LIM domain of chicken CRP1 was determined by nuclear magnetic resonance spectroscopy, and the protein fold of the tetrathiolate CCCC module was shown to be strikingly similar to that reported for the DNA-interactive CCCC modules within the DNA binding domains of the erythroid transcription factor GATA-1 and of the glucocorticoid receptor (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar). Despite this modular structural similarity to DNA-binding proteins, specific interaction of CRP proteins with nucleic acids has not yet been demonstrated. On the contrary, it has been inferred from protein affinity assays that CRP LIM domains are involved in specific protein-protein interactions (21Feuerstein R. Wang X. Song D. Cooke N.E. Liebhaber S.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10655-10659Google Scholar, 22Schmeichel K.L. Beckerle M.C. Cell. 1994; 79: 211-219Google Scholar, 23Arber S. Caroni P. Genes & Dev. 1996; 10: 289-300Google Scholar). So far, the solution structures of three LIM domains from unrelated LIM proteins have been determined by nuclear magnetic resonance spectroscopy: the carboxyl-terminal LIM domain (LIM2) from chicken CRP1 (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar), the single LIM domain from the developmentally regulated rat cysteine-rich intestinal protein (CRIP) (24Perez-Alvarado G.C. Kosa J.L. Louis H.A. Beckerle M.C. Winge D.R. Summers M.F. J. Mol. Biol. 1996; 257: 153-174Google Scholar), and the amino-terminal CCHC Zn(II)-binding module of the single LIM domain from the Lasp-1 protein encoded by a gene that was identified on the basis of its overexpression in human breast carcinoma (25Hammarström A. Berndt K.D. Sillard R. Adermann K. Otting G. Biochemistry. 1996; 35: 12723-12732Google Scholar). Here we present the solution structure of the carboxyl-terminal LIM domain (LIM2) from quail CRP2 and assess structural conservation and diversity between closely related but distinct members of the CRP family of LIM domain proteins that apparently fulfill diverse functions in cellular differentiation and growth control. A polymerase chain reaction was performed using DNA from the λgt10 clone W15 containing quail CSRP2(qCSRP2) cDNA (17Weiskirchen R. Bister K. Oncogene. 1993; 8: 2317-2324Google Scholar) as a template and the oligonucleotides 5′-d(CTAACCATGGACAGGGGAGAG)-3′ (SW001) and 5′-d(CTTATGAGTATTTCTTCCAGGGTA)-3′ (λgt10 reverse sequencing primer) as 5′ and 3′ primers, respectively. The SW001 primer corresponds to nucleotides 245–265 of the published qCSRP2 cDNA sequence (17Weiskirchen R. Bister K. Oncogene. 1993; 8: 2317-2324Google Scholar) with nucleotide substitutions at its 5′ end introducing a novel NcoI site. The polymerase chain reaction product was first digested with HindII cutting at a site in the 3′-untranslated region of CSRP2 cDNA and digested with NcoI to at the site by primer SW001 but an NcoI site. The was expression J.W. 1990; Scholar), been by in by DNA and digested by polymerase chain and to the of the CSRP2 the total nucleotide sequence of the polymerase chain reaction was determined by the chain using the sequencing and The expression encodes a acid amino acids of the carboxyl-terminal LIM domain (LIM2) (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar, R. Bister K. Oncogene. 1993; 8: 2317-2324Google Scholar). the expression of the protein in was transformed J.W. 1990; Scholar). at in containing and to an at of induced to by the of to a of and was for at The cells by and in of A 10 of the at by a and the cell was by at for The containing the protein was a in A. The was with of A the solution at and of was with of 10 of the analyzed by a Scholar) and by to protein and respectively. The of was of The structural and of the protein was by amino-terminal and the of zinc ions was analyzed by and of protein for was by and of the solution 10 The protein of used for from to of was performed by in of of of of in of with of an 2 of of 10 and and to of and respectively. was from an of at cells induced to by the of to a of and was for at The was as The of was of performed on a with a and resonance with The in and analyzed using and of of Scholar). for system and S. J. Chem. 1993; Scholar), A. J. Chem. Scholar), and G. K. 1990; Scholar), P. T. J. Chem. 1992; Scholar), and D. A. Biochemistry. Scholar). at and in to the from The properties of the protein not this was at and heteronuclear with in both The in a data with using a M. J. 1992; Scholar) double sequence for suppression and a A.J. Mol. Scholar) A was using to and a S. J. Chem. 1993; Scholar). The and the and from a data with The correlation P. T. J. Chem. 1992; Scholar) of from a 2 data with and a between of was with the of the sequence A.J. R. J. Scholar), using a used both in and The and performed with S. A. J. Chem. 1993; Scholar) and P. T. J. Chem. 1992; Scholar). The data by in both using and to and respectively. and to and respectively. was from the J. 91: Scholar). was with the of the two of with and of the with identical to the P. T. J. Chem. 1992; Scholar). The factor is as the of the in these two S. M. A. J. 1: Scholar). was by T and T as by R. G. T. J.D. Biochemistry. 1994; 33: Scholar) and analyzed to and J. G. J. 1995; Scholar). and identical to the and for the T 2 and and for the T respectively. by using of of Scholar) with three structures using in a and M. Scholar) using the A for and Scholar) on and In the first of and to a template structure with and and side to a of as strong and structure performed the zinc the zinc sites defined by tetrahedral of residues and and of residues and respectively. and for the zinc site structures with In the and for the and from the the the of was to as as The structures with used for using a with the S. M. J. Chem. Scholar). The hydrogen on the for hydrogen and by Lee Science. Scholar). In zinc was to of and to of of and and a of on the coordinating and the defined as S. M. J. Chem. of and using the R. M. K. J. Mol. 1996; Scholar). The have been in the A of the expression the of a acid with a of and an of amino acids of quail CRP2 the carboxyl-terminal LIM domain The recombinant protein was to in a single The and of recombinant was by amino-terminal amino acid revealed that a of the protein the that recombinant of of protein. of the amino acid sequence of the used in this with the sequence of the from chicken CRP1 is shown in A. The sequence within this region is between the chicken CRP1 and quail CRP2 proteins it is and quail CRP1 proteins are and chicken and quail CRP2 proteins differ by a single amino acid (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar). The structure of the quail CRP2 LIM2 domain with the CCHC and CCCC zinc-binding modules is shown in The chemical in a that a structure in a of are to with at this and conformational A total of are of the that one structural of the protein was present in is one for the of each in the protein. the K. of Proteins and Nucleic Scholar). In the of the was The was by from and in the region of the to either or and In side chain of residues with side not be to and in the region of the of of for T between and side chain are by In the are that in the amino-terminal CCHC module residues and the hydrophobic core region and structure elements identified on the basis of patterns in and found for residues that in antiparallel regions be identified by strong and The was by of strong was from chemical and The between and J. Mol. Biol. Scholar, Biochemistry. 1992; Scholar) are in A. is between the and the of structure elements from In and exhibit in to and from in the the structure found for residues and and be with is located in a region. the of of with used to hydrogen the as a function of is that is a in for residues located in loop regions of and of these with residues found in structure particular are the for of residues and They to defined hydrogen within structure both structures and the carboxyl-terminal magnetic relaxation data in terms of the by and J. G. J. 1995; Scholar) and structure 2 are to on to the of 2 the of is a correlation between and hydrogen within loop regions exhibit 2 with residues located in structure hydrogen on structural processes the of a hydrogen these indicate flexible sites that in the are to the hydrogen In regions of the CCCC the 2 are the The CCHC module 2 of a structure for the CCHC module with that of the CCCC to more specifically the of data and a more be in the of was derived from and the and in the CCHC module be performed in two The structures have than A of the from the structures is shown in The from the mean structure for and residues of the domain is is with a Science. Scholar). is the amino-terminal CCHC module and the carboxyl-terminal CCCC module are residues and structural of the structures of and 2 from from bond and for the tetrahedral of the zinc in both CCCC and CCHC modules is the with relative to mean from the of and of the structures by relative to mean from the of for the of residues of the of residues is as in and the CCHC and CCCC zinc-binding modules, and residues the LIM2 The bond and for the tetrahedral of the zinc in both CCCC and CCHC modules is the with relative to mean from the of and of the structures by relative to mean from the of for the of residues of the of residues is as in and the CCHC and CCCC zinc-binding modules, and residues the LIM2 in a A of the carboxyl-terminal domain of is in A and The domain with an via a type Lee Summers M.F. J. Chem. 1994; 18: Scholar), with hydrogen between and as as a hydrogen bond between and is by a is to the first one The regions between the two as as that between the two antiparallel and are flexible and to have hydrogen The residues a and the amino-terminal CCHC data 2 for and indicate conformational for these is to the zinc made for the residues involved in zinc binding within the zinc finger DNA binding domain of M. J. Chem. Scholar) and of the binding J. G. Biochemistry. 1996; 35: Scholar). the CCCC residues a containing a type with a similar hydrogen between and and between and a flexible loop from Glu155 to a antiparallel is formed by residues is the structure in both modules, as be not by the but by the chemical and K. of Proteins and Nucleic Scholar). A at defined within residues and of not in and not be A and of of the two independent modules CCHC and CCCC of with of chicken (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar). each module CCHC and is structural The for the CCHC module is and for the CCCC module an of was for chicken (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar), in the amino-terminal CCHC and carboxyl-terminal CCCC modules are together via a hydrophobic the side of residues and and have defined A of side chain interactions from of the the the of a hydrogen bond and/or salt between Glu155 and In the two be to and at a and two and from was that hydrogen of the in the of to a in T. J.D. Biochemistry. 1995; Scholar). The of that the hydrogen bond was not a but a side chain a revealed a of Glu155 and side chain and it was that and/or a hydrogen bond and/or salt to the side chain of these two residues are absolutely conserved within the CRP family of LIM proteins (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar), that are important for the relative orientation of the two zinc finger modules in the CRP LIM2 domains. In in the LIM domain the amino acid are and and the orientation of the two modules is different from that in CRP LIM2 domains (24Perez-Alvarado G.C. Kosa J.L. Louis H.A. Beckerle M.C. Winge D.R. Summers M.F. J. Mol. Biol. 1996; 257: 153-174Google Scholar). may indicate that not hydrophobic interactions in the core region but salt or hydrogen are important elements to the global fold of the CRP LIM2 is between and for hydrogen between and the of was found for chicken CRP1 (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar) and (24Perez-Alvarado G.C. Kosa J.L. Louis H.A. Beckerle M.C. Winge D.R. Summers M.F. J. Mol. Biol. 1996; 257: 153-174Google Scholar), and it was that this is an important interaction for the of the CCHC to the CCCC modules of chicken and (20Perez-Alvarado G.C. Miles C. Michelsen J.W. Louis H.A. Winge D.R. Beckerle M.C. Summers M.F. Nat. Struct. Biol. 1994; 1: 388-398Google Scholar, G.C. Kosa J.L. Louis H.A. Beckerle M.C. Winge D.R. Summers M.F. J. Mol. Biol. 1996; 257: 153-174Google Scholar), the CCCC module of structural to the CCCC modules of the glucocorticoid receptor and GATA-1 DNA-binding domains Nature. Scholar, J.G. O. G. C. E. Science. 1993; Scholar) and hence may a structure involved in acid in the loop of the CCCC module is that it is conserved in CRP proteins and conserved between CRP and the DNA-binding GATA-1 and receptor the loop the and in the CCHC module of conformational and this absolutely conserved between CRP proteins (12Weiskirchen R. Pino J.D. Macalma T. Bister K. Beckerle M.C. J. Biol. Chem. 1995; 270: 28946-28954Google Scholar). These two conserved loop in the CCHC and CCCC modules, conformational are located at the same side of the A and it is to suggest that their conformational may be for the of interactions with a DNA and of the binding biochemical and structural of CRP proteins, of the amino-terminal LIM1 domain and of between LIM1 and LIM2, be important to in the of the cellular for these proteins and to the basis for their diverse of for protein of and of for for for with the and for and for R. K. E. of and of for and