Reply

Potential conflict of interest: Nothing to report. We read with great interest the Bloks et al. correspondence and appreciate the important point raised by them regarding ABCG2. In the current analysis, we studied ABCG2 expression, and not that of ABCC2/MRP2, by using immunohistochemistry and quantitative polymerase chain reaction (PCR), as cited in the reference 3 of the article.1 However, we accidentally mixed up the names of these two molecules because they belong to the same ABC transporters and erroneously referred to ABCG2 as ABCC2 during the preparation of the manuscript. Whole‐exome sequencing did not show any specific mutation in the ABCG2 (and in the ABCC2) genes in both patients. The anti‐ABCG2 antibody for IHC was purchased from ALEXIS Co. (Lausen, Switzerland); the quantitative PCR primers used for measuring ABCG2 expression were TTCGGCTTGCAACAACTATGA (forward) and CACCACGGATAAACTGAGTTCCA (reverse). We are ready to open the detail of the methods so that these can be reproduced. Regarding the differences in the expression of ABCG2 on hepatocellular protoporphyrin deposition, we understand the concern being pointed out. Probably, it should be ideal to examine expression of ABCG2 in the liver of the older brother in the recovery phase; however, this was difficult owing to the ethical considerations and risk of complications. Therefore, we measured the levels of other membrane transporters, ABCG6 and PEPT1,1 together with ABCG2, by using quantitative PCR. We did not find any differences in ABCG6 and PEPT1 expression between the two brothers; the differences in ABCG2 expression were unique among the genes of transporter proteins examined. This result, at least partially, indicates that the reduction in ABCG2 levels in the older brother was a cause of the liver damage, and not its consequence. We also understand that the potential contribution of other candidate transporters in the development of erythropoietic protoporphyria‐associated liver disease deserves further investigation.