Abstract
21 min readBackground & Aims: Hepatocellular carcinoma (HCC) is the fifth most prevalent cancer worldwide and the third most lethal. Dysregulation of alternative splicing underlies a number of human diseases, yet its contribution to liver cancer has not been explored fully. The Krüppel-like factor 6 (KLF6) gene is a zinc finger transcription factor that inhibits cellular growth in part by transcriptional activation of p21. KLF6 function is abrogated in human cancers owing to increased alternative splicing that yields a dominant-negative isoform, KLF6 splice variant 1 (SV1), which antagonizes full-length KLF6–mediated growth suppression. The molecular basis for stimulation of KLF6 splicing is unknown. Methods: In human HCC samples and cell lines, we functionally link oncogenic Ras signaling to increased alternative splicing of KLF6 through signaling by phosphatidylinositol-3 kinase and Akt, mediated by the splice regulatory protein ASF/SF2. Results: In 67 human HCCs, there is a significant correlation between activated Ras signaling and increased KLF6 alternative splicing. In cultured cells, Ras signaling increases the expression of KLF6 SV1, relative to full-length KLF6, thereby enhancing proliferation. Abrogation of oncogenic Ras signaling by small interfering RNA (siRNA) or a farnesyl-transferase inhibitor decreases KLF6 SV1 and suppresses growth. Growth inhibition by farnesyl-transferase inhibitor in transformed cell lines is overcome by ectopic expression of KLF6 SV1. Down-regulation of the splice factor ASF/SF2 by siRNA increases KLF6 SV1 messenger RNA levels. KLF6 alternative splicing is not coupled to its transcriptional regulation. Conclusions: Our findings expand the role of Ras in human HCC by identifying a novel mechanism of tumor-suppressor inactivation through increased alternative splicing mediated by an oncogenic signaling cascade. Background & Aims: Hepatocellular carcinoma (HCC) is the fifth most prevalent cancer worldwide and the third most lethal. Dysregulation of alternative splicing underlies a number of human diseases, yet its contribution to liver cancer has not been explored fully. The Krüppel-like factor 6 (KLF6) gene is a zinc finger transcription factor that inhibits cellular growth in part by transcriptional activation of p21. KLF6 function is abrogated in human cancers owing to increased alternative splicing that yields a dominant-negative isoform, KLF6 splice variant 1 (SV1), which antagonizes full-length KLF6–mediated growth suppression. The molecular basis for stimulation of KLF6 splicing is unknown. Methods: In human HCC samples and cell lines, we functionally link oncogenic Ras signaling to increased alternative splicing of KLF6 through signaling by phosphatidylinositol-3 kinase and Akt, mediated by the splice regulatory protein ASF/SF2. Results: In 67 human HCCs, there is a significant correlation between activated Ras signaling and increased KLF6 alternative splicing. In cultured cells, Ras signaling increases the expression of KLF6 SV1, relative to full-length KLF6, thereby enhancing proliferation. Abrogation of oncogenic Ras signaling by small interfering RNA (siRNA) or a farnesyl-transferase inhibitor decreases KLF6 SV1 and suppresses growth. Growth inhibition by farnesyl-transferase inhibitor in transformed cell lines is overcome by ectopic expression of KLF6 SV1. Down-regulation of the splice factor ASF/SF2 by siRNA increases KLF6 SV1 messenger RNA levels. KLF6 alternative splicing is not coupled to its transcriptional regulation. Conclusions: Our findings expand the role of Ras in human HCC by identifying a novel mechanism of tumor-suppressor inactivation through increased alternative splicing mediated by an oncogenic signaling cascade. Alternative splicing is a nuclear process that contributes to expanded protein diversity from a limited number of genes. Dysregulation of alternative splicing may contribute to degenerative, developmental, and malignant diseases.1Cartegni L. Chew S.L. Krainer A.R. Listening to silence and understanding nonsense.Nat Rev Genet. 2002; 3: 285-298Crossref PubMed Scopus (1787) Google Scholar, 2Faustino N.A. Cooper T.A. Pre-mRNA splicing and human disease.Genes Dev. 2003; 17: 419-437Crossref PubMed Scopus (1011) Google Scholar, 3Pagani F. Barelle F.E. Genomic variants in exons and introns.Nat Rev Genet. 2004; 5: 389-396Crossref PubMed Scopus (484) Google Scholar Knowledge about alternative splicing in human hepatocellular carcinoma (HCC) is incomplete. Human cancers display alternatively spliced gene products in the absence of genomic mutations, pinpointing the splicing machinery as a cause of disease.1Cartegni L. Chew S.L. Krainer A.R. Listening to silence and understanding nonsense.Nat Rev Genet. 2002; 3: 285-298Crossref PubMed Scopus (1787) Google Scholar, 2Faustino N.A. Cooper T.A. Pre-mRNA splicing and human disease.Genes Dev. 2003; 17: 419-437Crossref PubMed Scopus (1011) Google Scholar, 3Pagani F. Barelle F.E. Genomic variants in exons and introns.Nat Rev Genet. 2004; 5: 389-396Crossref PubMed Scopus (484) Google Scholar In general, affected proteins include transcription factors, cell signal transducers, and components of the extracellular matrix. Other examples in which alternatively spliced transcripts are increased in human cancers include LKB1 (premature termination codon), KIT (aberrant splicing leading to constitutively activated receptor tyrosine kinase), CDH17 (unknown mechanism), and BRCA1 (exon skipping).4Srebrow A. Kornblihtt A.R. The connection between splicing and cancer.J Cell Sci. 2006; 119: 2635-2641Crossref PubMed Scopus (284) Google Scholar Although the role of alternative splicing in cancer is not well characterized, in normal tissues alternative splicing is regulated by specific signaling pathways, yielding temporally and spatially appropriate patterns of gene expression.5Xie J. Jan C. Stoilov P. et al.A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels.Nature. 2001; 410: 936-939Crossref PubMed Scopus (215) Google Scholar, 6van der Houven van Oordt W. Diaz-Meco M.T. Lozano J. et al.The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1.J Cell Biol. 2000; 149: 307-316Crossref PubMed Scopus (289) Google Scholar, 7Matter N. Herrlich P. König H. Signal-dependent regulation of splicing via phosphorylation of Sam68.Nature. 2002; 420: 691-695Crossref PubMed Scopus (384) Google Scholar, 8Weg-Remers S. Ponta H. Herrlich P. et al.Regulation of alternative pre-mRNA splicing by the ERK MAP-kinase pathway.EMBO J. 2001; 20: 4194-4203Crossref PubMed Scopus (145) Google Scholar For example, pre–messenger RNA (mRNA) alternative splicing mediated by Sam68, a member of the signal transduction and activation of RNA family of proteins, has been linked directly to Ras signaling. Specifically, Ras-mediated phosphorylation of Sam68 activates alternative splicing of CD44 pre-mRNA, a cell surface molecule and hyaluronic acid receptor, inducing expression of CD44v5 in an extracellular signal-regulated kinase (ERK)-dependent manner.7Matter N. Herrlich P. König H. Signal-dependent regulation of splicing via phosphorylation of Sam68.Nature. 2002; 420: 691-695Crossref PubMed Scopus (384) Google Scholar Although the normal function of this isoform currently is unknown, CD44v5 can contribute to carcinogenesis by enhancing tumor cell invasion in a SRm160-dependent manner.9Cheng C. Sharp P.A. Regulation of CD44 alternative splicing by SRm160 and its potential role in tumor cell invasion.Mol Cell Biol. 2006; 26: 362-370Crossref PubMed Scopus (171) Google Scholar In addition, monoclonal antibody-mediated neutralization of CD44 eliminates the oncogenic potential of leukemic stem cells.10Jin L. Hope K.J. Zhai Q. et al.Targeting of CD44 eradicates human acute myeloid leukemic stem cells.Nat Med. 2006; 12: 1167-1174Crossref PubMed Scopus (1028) Google Scholar, 11Krause D.S. Lazarides K. von Andrian U.H. et al.Requirement for CD44 in homing and engraftment of BCR-ABL-expressing leukemic stem cells.Nat Med. 2006; 12: 1175-1180Crossref PubMed Scopus (363) Google Scholar Although signals that increase splicing of CD44 may lead to tumor enhancement, there are no examples in which a signaling pathway leads to functional inactivation of tumor-suppressor genes in human cancers through dysregulated alternative splicing. Moreover, although alternative splicing of tumor-suppressor genes such as BRCA1,12Cho Y.G. Kim C.J. Park C.H. et al.Genetic alterations of the KLF6 gene in gastric cancer.Oncogene. 2005; 24: 4588-4590Crossref PubMed Scopus (60) Google Scholar, 13Fortin J. Moisan A.M. Dumont M. et al.A new alternative splice variant of BRCA1 containing an additional in-frame exon.Biochim Biophys Acta. 2005; 1731: 57-65Crossref PubMed Scopus (15) Google Scholar WT1,14Hastie N.D. Life, sex, and WT1 isoforms.Cell. 2001; 106: 391-394Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar NF1,15Vandenbroucke I. Vandesompele J. De Paepe A. et al.Quantification of NF1 transcripts reveals novel highly expressed splice variants.FEBS Lett. 2002; 522: 71-76Crossref PubMed Scopus (34) Google Scholar Men1,16Forsberg L. Zablewska B. Piehl F. et al.Differential expression of multiple alternative spliceforms of the Men1 tumor suppressor gene in mouse.Int J Mol Med. 2001; 8: 681-689PubMed Google Scholar p53,17Laverdiere M. Beaudoin J. Lavigueur A. Species-specific regulation of alternative splicing in the C-terminal region of p53.Nucleic Acids Res. 2000; 28: 1489-1497Crossref PubMed Scopus (27) Google Scholar and PTEN18Sharrard R.M. Maitland N.J. Alternative splicing of the human PTEN/MMAC1/TEP1 gene.Biochim Biophys Acta. 2000; 1494: 282-285Crossref PubMed Scopus (31) Google Scholar has been described, the signals that result in their dysregulated splicing are not yet defined. Krüppel-like factor 6 (KLF6) is a ubiquitously expressed zinc finger transcription factor and tumor-suppressor gene that is inactivated in several human cancers, including HCC, by loss of heterozygosity and/or inactivating mutations.19Chen C. Hyytinen E.R. Sun X. et al.Deletion, mutation, and loss of expression of KLF6 in human prostate cancer.Am J Pathol. 2003; 162: 1349-1354Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 20Reeves H.L. Narla G. Ogunbiyi O. et al.Kruppel-like factor 6 (KLF6) is a tumor-suppressor gene frequently inactivated in colorectal cancer.Gastroenterology. 2004; 126: 1090-1103Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar, 21Narla G. Heath K.E. Reeves H.L. et al.KLF6, a candidate tumor suppressor gene mutated in prostate cancer.Science. 2001; 294: 2563-2566Crossref PubMed Scopus (390) Google Scholar, 22Jeng Y.M. Hsu H.C. KLF6, a putative tumor suppressor gene, is mutated in astrocytic gliomas.Int J Cancer. 2003; 105: 625-629Crossref PubMed Scopus (82) Google Scholar KLF6 can suppress growth by p53-independent up-regulation of p21,21Narla G. Heath K.E. Reeves H.L. et al.KLF6, a candidate tumor suppressor gene mutated in prostate cancer.Science. 2001; 294: 2563-2566Crossref PubMed Scopus (390) Google Scholar sequestration of cyclin D1,23Benzeno S. Narla G. Allina J. et al.Cyclin-dependent kinase inhibition by the KLF6 tumor suppressor protein.Cancer Res. 2004; 64: 3885-3891Crossref PubMed Scopus (134) Google Scholar and/or antagonism of the c-jun proto-oncogene.24Slavin D.A. Koritschoner N.P. Prieto C.C. et al.A new role for the Kruppel-like transcription factor KLF6 as an inhibitor of c-Jun proto-oncoprotein function.Oncogene. 2004; 23: 8196-8205Crossref PubMed Scopus (76) Google Scholar We recently characterized 3 alternative splice variants of KLF6 that encode truncated isoforms (supplementary Figure 1; see supplementary material online at www.gastrojournal.org), at least one of which, KLF6 splice variant 1 (SV1), acts as a dominant-negative protein that antagonizes full-length KLF6 (KLF6Full).25Narla G. Difeo A. Reeves H.L. et al.A germline DNA polymorphism enhances alternative splicing of the KLF6 tumor suppressor gene and is associated with increased prostate cancer risk.Cancer Res. 2005; 65: 1213-1222Crossref PubMed Scopus (193) Google Scholar Significant overexpression of SV1 has been identified in several human cancers including prostate,26Narla G. DiFeo A. Yao S. et al.Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread.Cancer Res. 2005; 65: 5761-5768Crossref PubMed Scopus (138) Google Scholar ovarian,27DiFeo A. Narla G. Hirshfeld J. et al.Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination.Clin Cancer Res. 2006; 12: 3730-3739Crossref PubMed Scopus (97) Google Scholar and HCCs.28Kremer-Tal S. Narla G. Chen Y. et al.Downregulation of KLF6 is an early event in hepatocarcinogenesis.J Hepatol. 2007; 46: 645-654Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar Overexpression of KLF6 SV1 in human tumors correlates with poorer outcome and reduced survival.27DiFeo A. Narla G. Hirshfeld J. et al.Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination.Clin Cancer Res. 2006; 12: 3730-3739Crossref PubMed Scopus (97) Google Scholar In contrast, targeted inhibition of KLF6 SV1 suppresses prostate and ovarian cancer cell growth26Narla G. DiFeo A. Yao S. et al.Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread.Cancer Res. 2005; 65: 5761-5768Crossref PubMed Scopus (138) Google Scholar, 27DiFeo A. Narla G. Hirshfeld J. et al.Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination.Clin Cancer Res. 2006; 12: 3730-3739Crossref PubMed Scopus (97) Google Scholar, 29DiFeo A. Narla G. Camacho-Vanegas O. et al.E-cadherin is a novel transcriptional target of the KLF6 tumor suppressor.Oncogene. 2006; 25: 6026-6031Crossref PubMed Scopus (68) Google Scholar both in vivo and in vitro. These studies indicate that the net activity of KLF6 can be regulated by the relative expression of KLF6Full compared with SV1, such that either a relative increase in SV1 and/or decrease in KLF6Full can promote cellular growth.26Narla G. DiFeo A. Yao S. et al.Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread.Cancer Res. 2005; 65: 5761-5768Crossref PubMed Scopus (138) Google Scholar, 27DiFeo A. Narla G. Hirshfeld J. et al.Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination.Clin Cancer Res. 2006; 12: 3730-3739Crossref PubMed Scopus (97) Google Scholar, 29DiFeo A. Narla G. Camacho-Vanegas O. et al.E-cadherin is a novel transcriptional target of the KLF6 tumor suppressor.Oncogene. 2006; 25: 6026-6031Crossref PubMed Scopus (68) Google Scholar Although the functional outcomes of KLF6 alternative splicing have become clearer, the pathways regulating KLF6 alternative splicing remain obscure. With the recognition that Ras regulates pre-mRNA alternative splicing in normal cells (eg, Sam68), we explored a potential functional link between enhanced tumor-suppressor alternative splicing and Ras dysregulation in human HCC. Specifically, oncogenic Ras signaling via phosphatidylinositol (PI)3-K/Akt leads to increased alternative splicing of KLF6, and, furthermore, KLF6 alternative splicing partly mediates Ras's growth-promoting effects. These data link oncogene-mediated alternative splicing of a tumor-suppressor gene to its functional inactivation in HCC. Human HCCs were obtained as described recently.30Wurmbach E. Chen Y.B. Khitrov G. et al.Genome-wide molecular profiles of HCV-induced dysplasia and hepatocellular carcinoma.Hepatology. 2007; 45: 938-947Crossref PubMed Scopus (583) Google Scholar, 31Llovet J.M. Chen Y. Wurmbach E. et al.A molecular signature to discriminate dysplastic nodules from early hepatocellular carcinoma in HCV cirrhosis.Gastroenterology. 2006; 131: 1758-1767Abstract Full Text Full Text PDF PubMed Scopus (334) Google Scholar A total of 67 fresh-frozen HCC samples from hepatitis C virus–positive patients were analyzed in the study. Patients with hepatitis B virus–positive markers or a background of alcohol consumption, nonalcoholic steatohepatitis, hemochromatosis, or other cause of chronic liver disease were excluded. Lesions previously treated by percutaneous ablation or chemoembolization/lipidolization also were excluded. The liver sample set included the following histologic groups: HCC patient samples including early advanced HCC (large HCC with microvascular invasion or satellites and/or poorly differentiated tumors), and very advanced HCC (with evidence of macrovascular invasion or extrahepatic metastases). Genomic DNA samples were amplified using Clontech Advantage (Carpenteria, CA) polymerase chain reaction (PCR) plates. Primers are available on request. Genewiz, Inc (Paramus, NJ) purified and then directly sequenced PCR products. Data were analyzed using Sequencher (Gene Codes, Ann Arbor, MI). Cell lines were obtained from ATCC (Manassas, VA). Live cells and mRNA from HCT116, DLD-1, and their daughter cell lines (except Hke-3) were obtained from the Beatson Institute for Cancer Research, (Glasgow, UK); live Hke-3 cells were never obtained because of x-irradiation during shipment. Chemicals used in studies included Akt Inhibitor V, triciribine, LY 294002 in solution, JNK Inhibitor II in solution, U0126, Akt Inhibitor VII, epidermal growth factor (EGF)-receptor inhibitor, phorbol-12-myristate-13-acetate (all from Calbiochem, Darmstadt, Germany), and rapamycin (Sigma, St Louis, MO). Modified siRNA duplexes were purchased from Invitrogen (Carlsbad, CA). Transfections were performed using Lipofectamine 2000 reagent (Invitrogen). Polyclonal pools of stable cell lines were generated by retroviral infection of pBabe-Ctrl, pBabe-KLF6, and pBabe-SV1 plasmids. Infected cells were selected with 2 μg/mL of puromycin. For each construct, at least 2 independent polyclonal pools of stable cell lines were generated and analyzed. As previously described,21Narla G. Heath K.E. Reeves H.L. et al.KLF6, a candidate tumor suppressor gene mutated in prostate cancer.Science. 2001; 294: 2563-2566Crossref PubMed Scopus (390) Google Scholar proliferation was determined by assaying [3H]-thymidine incorporation. Cells were plated at a density of 50,000 cells per well in 12-well dishes. At appropriate time points after plating, 1 μCi/mL [3H]-thymidine (Amersham, Piscataway, NJ) was added. After 2 hours, cells were washed 3 times with ice-cold phosphate-buffered saline (PBS) and fixed in methanol for 30 minutes at 4°C. After methanol removal and cell drying, cells were solubilized in 0.25% sodium hydroxide/0.25% sodium dodecyl sulfate. After neutralization with hydrochloric acid (1 N), disintegrations per minute were estimated by liquid scintillation counting. RNA from cell lines and tumors was extracted using the RNeasy Mini and Midi kit (Qiagen, Valencia, CA). RNA was treated with DNase (Roche, Basel, Switzerland). One microgram of total RNA was reverse-transcribed per reaction using first-strand complementary DNA synthesis with random primers (Clontech). Quantitative real-time PCR was performed on a Roche LightCycler 480. Experiments were performed in triplicate 3 independent times. All values were normalized to glyceraldehyde-3-phosphate dehydrogenase and β-actin. KLF6 primer sequences and protocols have been described previously25Narla G. Difeo A. Reeves H.L. et al.A germline DNA polymorphism enhances alternative splicing of the KLF6 tumor suppressor gene and is associated with increased prostate cancer risk.Cancer Res. 2005; 65: 1213-1222Crossref PubMed Scopus (193) Google Scholar, 26Narla G. DiFeo A. Yao S. et al.Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread.Cancer Res. 2005; 65: 5761-5768Crossref PubMed Scopus (138) Google Scholar, 27DiFeo A. Narla G. Hirshfeld J. et al.Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination.Clin Cancer Res. 2006; 12: 3730-3739Crossref PubMed Scopus (97) Google Scholar, 28Kremer-Tal S. Narla G. Chen Y. et al.Downregulation of KLF6 is an early event in hepatocarcinogenesis.J Hepatol. 2007; 46: 645-654Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar; K-ras-F: GCTGGTGGCGTAGGCAAGAG; K-ras-R: CTCCTCTTGACCTGCTGTGTCG; H-ras-F: AGGAGACCCTGTAGGAGGA; H-ras-R: CGCTAGGCTCACCTCTATAGTG; PI3-K–F: CTGTGTGGGACTTATTGAGGTGGTGC; PI3-K–R: GGCATGCTGTCGAATAGCTAGATAAGC. Statistical significance was determined by analysis of variance. Cells were lysed in Lysis M buffer (Roche), and lysates were sonicated and pelleted. Supernatants were denatured and 30 μg of protein was separated by polyacrylamide gel electrophoresis (Invitrogen), and then transferred to nitrocellulose membranes (Invitrogen). The following antibodies were used: Akt (Cell Signaling, Danvers, MA), phospho-Akt (Cell Signaling), β-actin (Santa Cruz, CA), and secondary anti-goat (Santa Cruz) and anti-rabbit (Amersham) antibodies. Enhanced chemiluminescence images were analyzed and quantified with a Bioquant Nova (Bioquant Lifesciences, Nashville, TN). Values were normalized to control and expressed as relative fold changes. 293T cells were transfected with pGL3-KLF6–promoter luciferase constructs (1 μg) and a K-rasV12 expression plasmid or K-ras siRNA oligonucleotides (Invitrogen) as indicated in the Results section, together with the p21WAF1/Cip1 promoter-luciferase construct. Five nanograms of pRL-TK plasmid (Promega, Madison, WI) were cotransfected as a control for transfection efficiency. Twenty-four hours after transfection, cells were washed with cold PBS and lysates were prepared using the dual-luciferase Reporter Assay system (Promega). Luciferase activity in 10 μL of lysate was determined on a luminometer (Dynex Technologies, Chantilly, VA). The p21 promoter construct consists of 181 bp upstream of the transcriptional start site.21Narla G. Heath K.E. Reeves H.L. et al.KLF6, a candidate tumor suppressor gene mutated in prostate cancer.Science. 2001; 294: 2563-2566Crossref PubMed Scopus (390) Google Scholar Within these 181 bp are 2 known transcription factor binding motifs: a CCAAT box, which binds p53, and a GC box, which binds KLF6 and other KLFs. To test for an association between Ras and KLF6 in vivo, we examined 67 advanced and very advanced HCC samples for activated Ras signaling and KLF6 alternative splicing. Activated Ras signaling was assessed by 2 methods: sequencing for guanosine triphosphatase–inhibiting K-ras point mutations in codons 12, 13, and 61 that result in constitutive protein function; and real-time quantitative PCR (qPCR) analysis of H-ras mRNA expression. KLF6 alternative splicing was measured by real-time qPCR with isoform-specific primers. A large proportion (50 of 67; 75%) of these advanced and very advanced HCCs displayed increased H-ras mRNA, and were classified as high H-ras samples (Table 1), whereas only 1 of 67 samples harbored a mutant K-ras allele (data not shown). Three independent H-ras primer sets were used to measure and verify over expression (supplementary Table 1; see supplementary material online at www.gastrojournal.org). Increased KLF6 alternative splicing, expressed as a ratio of KLF6 SV1 to KLF6Full, was present in 51 of 67 (76%) HCC samples (Table 1). When the level of H-ras was compared against KLF6 splicing by nonparametric chi-square analysis, there was a significant correlation between increased H-ras expression and increased KLF6 alternative splicing, supporting an association between Ras activation and KLF6 splicing (Table 1).Table 1In Vivo Relationship Linking Activated Ras Signaling to Increased KLF6 Alternative SplicingH-ras expressionKLF6 alternative splicingLowHighTotalLow11617High153550Total165167NOTE. Df = 1; χ2 = 4.05; P < .05.χ2 analysis results indicated significant correlation between H-ras expression and KLF6 alternative splicing in human HCC tumors. Median curves were implemented to determine high (for H-ras, >3-fold overexpression; for KLF6 alternative splicing, >5-fold over expression) and low expression. Open table in a new tab NOTE. Df = 1; χ2 = 4.05; P < .05. χ2 analysis results indicated significant correlation between H-ras expression and KLF6 alternative splicing in human HCC tumors. Median curves were implemented to determine high (for H-ras, >3-fold overexpression; for KLF6 alternative splicing, >5-fold over expression) and low expression. To further elucidate the signaling cascades that regulate KLF6 alternative splicing, several cell lines were incubated with Phorbol-12-myristate-13-Acetate (TPA), a potent and immediate activator of protein kinase C, Ras, and its downstream effectors, the mitogen-activated protein kinases and PI3-K. Addition of TPA to the 293T human fibroblast cell line, which expresses wild-type Ras, significantly increased KLF6 SV1 mRNA at 24 hours, as determined by splice form-specific real-time qPCR (Figure 1A). KLF6 alternative splicing increased as early as 3 hours after TPA treatment (data not shown). These results were verified using standard reverse-transcription PCR and agarose gel electrophoresis (data not shown). In PC3M cells, a metastatic prostate cancer line with constitutively active Ras signaling, KLF6 SV1 mRNA also was increased significantly by TPA, but to a much lesser extent (Figure 1A). Specifically, compared with 293T cells, PC3M cells, which are known to harbor highly increased Ras signaling, displayed increased baseline levels of KLF6 SV1 mRNA (data not shown), suggesting that Ras-dependent splicing already may be activated in this line. Similar to 293T cells, increases in SV1 mRNA after TPA treatment also were observed in the human HCC cell lines Hep3B and Huh7, as well as the human hepatoblastoma cell line HepG2 (Figure 1B). We next examined whether farnesylthiosalicylic acid (FTS), a farnesyl-transferase inhibitor that prevents Ras proteins from localizing to the inner cell membrane and hence prevents signal transduction,32Reif S. Weis B. Aeed H. et al.The Ras antagonist, farnesylthiosalicylic acid (FTS), inhibits experimentally-induced liver cirrhosis in rats.J Hepatol. 1999; 31: 1053-1061Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar blocked TPA-induced KLF6 alternative splicing. Indeed, when the cell lines Hep3B, Huh7, and HepG2 were incubated with TPA and FTS together, there were no significant changes in KLF6Full or SV1 expression (Figure 1C), suggesting that Ras signaling was necessary during TPA-induced KLF6 splicing. Furthermore, Western analyses of these experiments (Figure 1D) confirmed Ras-dependent Akt phosphorylation in this cellular context, validating the use of p-Akt as a marker of Ras activity. These results also implicated Ras-dependent Akt as a potential KLF6 splicing regulator, a hypothesis we tested (described later). Activated Ras signaling and Ras-dependent Akt phosphorylation for the experiments in Figures 1A and B were confirmed by increased phosphorylation of Akt in 293T and Hep3B cell lines (Figure 1E, results are representative of all cell lines). These findings supported the prospect that induction of Ras by TPA contributed to enhanced alternative splicing of KLF6 and generation of KLF6 SV1. To address this possibility specifically, 293T, BPH1 (a benign prostatic hyperplasia cell line characterized by an intermediate level of Ras signaling33Shou J. Soriano R. Hayward S.W. et al.Expression profiling of a human cell line model of prostatic cancer reveals a direct involvement of IFN signaling in prostate tumor progression.Proc Natl Acad Sci U S A. 2002; 99: 2830-2835Crossref PubMed Scopus (87) Google Scholar), and PC3M cells were transfected transiently with an oncogenic H-ras expression vector, and expression of KLF6 SV1 was quantified. H-ras transfection significantly increased KLF6 SV1 mRNA in 293T and BPH1 cells, but not PC3M (supplementary Figure 2A; see supplementary material online at www.gastrojournal.org). Activated Ras signaling was confirmed by increased phospho-Akt in 293T cells (supplementary Figure 2B; see supplementary material online at www.gastrojournal.org). Interestingly, the expression pattern of KLF6 SV1 in these cells parallels the relative activity of Ras. For example, in PC3M cells, where Ras signaling is constitutively active, ectopic expression of oncogenic Ras did not further increase KLF6 SV1 mRNA (supplementary Figure 2A; see supplementary material online at www.gastrojournal.org). We next explored the potential role of K-ras in KLF6 alternative splicing because this Ras isoform is expressed more ubiquitously than H-ras in human tissues. Similar to experiments with H-ras, transient transfection of oncogenic K-ras into BPH1 and PC3M cells resulted in significantly increased KLF6 SV1 mRNA only in BPH1 cells (supplementary Figure 2C; see supplementary material online at www.gastrojournal.org), indicating that splicing was enhanced by Ras, but primarily in cells not already expressing an activated isoform. To further link Ras to KLF6 alternative splicing, cells were incubated with FTS. Incubation of Hep3B, Huh7, and HepG2 cells with farnesyl-transferase inhibitor significantly decreased KLF6 SV1 mRNA in all 3 lines, whereas KLF6Full mRNA expression remained unchanged (Figure 1F, upper panel). FTS-mediated inhibition of Ras signaling was confirmed by decreased phospho-Akt in Huh7 and HepG2 cells (Figure 1F, lower panel). Rather than relying solely on exogenous manipulation of human cancer cell lines, we used a somatic cell system using 2 sublines of HCT116 (Hkh-2 and Hke-3) and DLD-1 (Dko-4 and Dks-8) colon cancer cells in which one K-ras allele has been genetically deleted through homologous recombination. The Hkh-2 and Hke-3 lines express a
Discussion(0)
No comments yet. Be the first to comment.