Abstract
22 min readInterleukin-10 (IL-10) is a cytokine that has pleiotropic effects on a variety of different cell types. Although many of the biologic responses induced by IL-10 are also induced by other cytokines, such as IL-6, IL-10 is relatively unique in its ability to potently inhibit production of pro-inflammatory cytokines in macrophages. In this study, we have used gain-of-function and loss-of-function genetic approaches to define the intracellular components involved in the different biologic actions of IL-10. Herein, we demonstrate that the ability of IL-10 to inhibit tumor necrosis factor α (TNFα) production in lipopolysaccharide-stimulated macrophages requires the presence of Stat3, Jak1, and two distinct regions of the IL-10 receptor intracellular domain. Macrophages deficient in Stat3 or Jak1 were unable to inhibit lipopolysaccharide-induced TNFα production following treatment with murine IL-10. Structure-function analysis of the intracellular domain of the IL-10 receptor α chain showed that whereas two redundant Stat3 recruitment sites (427YQKQ430 and477YLKQ480) were required for all IL-10-dependent effects on either B cells or macrophages, expression of IL-10-dependent anti-inflammatory function required the presence on the intracellular domain of the IL-10 receptor of a carboxyl-terminal sequence containing at least one functionally critical serine. These results thus demonstrate that IL-10-induced inhibition of TNFα production requires two distinct regions of the IL-10 receptor intracellular domain and thereby establish a distinctive molecular basis for the developmental versus the anti-inflammatory actions of IL-10. Interleukin-10 (IL-10) is a cytokine that has pleiotropic effects on a variety of different cell types. Although many of the biologic responses induced by IL-10 are also induced by other cytokines, such as IL-6, IL-10 is relatively unique in its ability to potently inhibit production of pro-inflammatory cytokines in macrophages. In this study, we have used gain-of-function and loss-of-function genetic approaches to define the intracellular components involved in the different biologic actions of IL-10. Herein, we demonstrate that the ability of IL-10 to inhibit tumor necrosis factor α (TNFα) production in lipopolysaccharide-stimulated macrophages requires the presence of Stat3, Jak1, and two distinct regions of the IL-10 receptor intracellular domain. Macrophages deficient in Stat3 or Jak1 were unable to inhibit lipopolysaccharide-induced TNFα production following treatment with murine IL-10. Structure-function analysis of the intracellular domain of the IL-10 receptor α chain showed that whereas two redundant Stat3 recruitment sites (427YQKQ430 and477YLKQ480) were required for all IL-10-dependent effects on either B cells or macrophages, expression of IL-10-dependent anti-inflammatory function required the presence on the intracellular domain of the IL-10 receptor of a carboxyl-terminal sequence containing at least one functionally critical serine. These results thus demonstrate that IL-10-induced inhibition of TNFα production requires two distinct regions of the IL-10 receptor intracellular domain and thereby establish a distinctive molecular basis for the developmental versus the anti-inflammatory actions of IL-10. Interleukin-10 (IL-10) 1The abbreviations used are: IL, interleukin; muIL, murine IL; huIL, human IL; ELISA, enzyme-linked immunosorbent assay; TNF, tumor necrosis factor; IFN, interferon; LPS, lipopolysaccharide. is a cytokine produced by Th0 and Th2 CD4+ T cells, CD5+ B cells, thymocytes, ketatinocytes, and macrophages (1Liu Y. Wei S.H.-Y. Ho A.S.-Y. deWaal Malefyt R. Moore K.W. J. Immunol. 1993; 152: 1821-1829Google Scholar, 2Moore K.W. O'Garra A. de Waal Malefyt R. Vieira P. Mosmann T.R. Annu. Rev. Immunol. 1993; 11: 165-190Crossref PubMed Scopus (2379) Google Scholar, 3Moore K.W. Vieira P. Fiorentino D.F. Trounstine M.L. Khan T. Mosmann T.R. Science. 1990; 248: 1230-1234Crossref PubMed Scopus (1006) Google Scholar, 4Oswald I.P. Wynn T.A. Sher A. James S.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 89: 8676-8680Crossref Scopus (325) Google Scholar, 5Rousset F. Garcia E. Defrance T. Peronne C. Vessio N. Hsu D.-H. Kastelein R. Moore K.W. Banchereau J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1890-1893Crossref PubMed Scopus (1144) Google Scholar) that regulates the function and/or development of both lymphoid and myeloid cells (2Moore K.W. O'Garra A. de Waal Malefyt R. Vieira P. Mosmann T.R. Annu. Rev. Immunol. 1993; 11: 165-190Crossref PubMed Scopus (2379) Google Scholar, 6Howard M. O'Garra A. Immunol. Today. 1992; 13: 198-200Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 7Mosmann T.R. Adv. Immunol. 1994; 56: 1-26Crossref PubMed Google Scholar). One of the most unique actions of this cytokine is its ability to inhibit production of pro-inflammatory cytokines, such as tumor necrosis factor α (TNFα), IL-1, and IL-12, which are synthesized by macrophages in response to bacterial products, such as lipopolysaccharide (LPS). This activity results in decreased IFNγ production and inhibition of cell-mediated immune responses while concomitantly enhancing humoral immunity (6Howard M. O'Garra A. Immunol. Today. 1992; 13: 198-200Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 8Mosmann T.R. Int. Arch. Allergy Appl. Immunol. 1991; 94: 110-115Crossref PubMed Scopus (61) Google Scholar, 9O'Garra A.O. Stapleton G. Dhar V. Pearce M. Schumacher J. Rugo H. Barbis D. Stall A. Cupp J. Moore K. Vieira P. Mosmann T. Whitmore A. Arnold L. Haughton G. Howard M. Int. Immunol. 1990; 2: 821-831Crossref PubMed Scopus (327) Google Scholar, 10Taga K. Mostowski H. Tosato G. Blood. 1993; 81: 2964-2971Crossref PubMed Google Scholar). IL-10 exerts its biologic effects on cells by interacting with a specific cell surface receptor (1Liu Y. Wei S.H.-Y. Ho A.S.-Y. deWaal Malefyt R. Moore K.W. J. Immunol. 1993; 152: 1821-1829Google Scholar, 11Ho A.S.Y. Liu Y. Khan T.A. Hsu D.-H. Bazan J.F. Moore K.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11267-11271Crossref PubMed Scopus (218) Google Scholar). Functionally active IL-10 receptors are composed of two distinct subunits. Both subunits belong to the class II cytokine receptor family that also contains the receptors for IFNα and IFNγ (12Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6934-6938Crossref PubMed Scopus (1881) Google Scholar). The IL-10 receptor α chain is a 110-kDa polypeptide that plays the dominant role in mediating high affinity ligand binding and signal transduction (1Liu Y. Wei S.H.-Y. Ho A.S.-Y. deWaal Malefyt R. Moore K.W. J. Immunol. 1993; 152: 1821-1829Google Scholar, 11Ho A.S.Y. Liu Y. Khan T.A. Hsu D.-H. Bazan J.F. Moore K.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11267-11271Crossref PubMed Scopus (218) Google Scholar). The IL-10 receptor β subunit (also known as CRF2–4) is predicted to be a 40-kDa polypeptide that is largely required only for signaling (13Spencer S.D. Di Marco F. Hooley J. Pitts-meek S. Bauer M. Ryan A.M. Sordat B. Gibbs V.C. Aguet M. J. Exp. Med. 1998; 187: 571-578Crossref PubMed Scopus (305) Google Scholar,14Kotenko S.V. Krause C.D. Izotova L.S. Pollack B.P. Wu W. Pestka S. EMBO J. 1997; 16: 5894-5903Crossref PubMed Scopus (333) Google Scholar). Engagement of the IL-10 receptor has been shown to activate the JAK-STAT signaling pathway. Specifically, IL-10 effects the activation of Jak1 (associated with the IL-10 receptor α chain) and Tyk2 (associated with the IL-10 receptor β chain) and induces the activation of Stat1, Stat3, and, in some cells, Stat5 (15Finbloom D.S. Winestock K.D. J. Immunol. 1995; 155: 1079-1090PubMed Google Scholar, 16Ho A.S.-Y. Wei S.H.-Y. Mui A.L.-F. Miyajima A. Moore K.W. Mol. Cell. Biol. 1995; 15: 5043-5053Crossref PubMed Scopus (102) Google Scholar, 17Lai C.-F. Ripperger J. Morella K.K. Jurlander J. Hawley T.S. Carson W.E. Kordula T. Caligiuri M.A. Hawley R.G. Fey G.H. Baumann H. J. Biol. Chem. 1996; 271: 13968-13975Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 18Weber-Nordt R.M. Riley J.K. Greenlund A.C. Moore K.W. Darnell J.E. Schreiber R.D. J. Biol. Chem. 1996; 271: 27954-27961Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 19Wehinger J. Gouilleux F. Groner B. Finke J. Mertelsmann R. Weber-Nordt R.M. FEBS Lett. 1996; 394: 365-370Crossref PubMed Scopus (141) Google Scholar). Previous work from our laboratory using cells from mice with disrupted genes for Jak1 and Stat1 has revealed that the characteristic ability of IL-10 to inhibit TNFα production in LPS-stimulated macrophages (i.e. anti-inflammatory actions of IL-10) displays an obligate dependence on Jak1 but does not require the presence of Stat1 (20Meraz M.A. White J.M. Sheehan K.C.F. Bach E.A. Rodig S.J. Dighe A.S. Kaplan D.H. Riley J.K. Greenlund A.C. Campbell D. Carver-Moore K. DuBois R.N. Clark R. Aguet M. Schreiber R.D. Cell. 1996; 84: 431-442Abstract Full Text Full Text PDF PubMed Scopus (1401) Google Scholar, 21Rodig S.J. Meraz M.A. White J.M. Lampe P.A. Riley J.K. Arthur C.D. King K.L. Sheehan K.C.F. Yin L. Pennica D. Johnson E.M. Schreiber R.D. Cell. 1998; 93: 373-383Abstract Full Text Full Text PDF PubMed Scopus (671) Google Scholar). Thus, whereas the Janus kinases are clearly required for promoting the anti-inflammatory effects of IL-10, it remains uncertain which STAT protein, if any, is involved in mediating these unique IL-10-induced responses. Other studies have suggested that Stat3 participates in manifesting at least some of the biologic effects of IL-10 on B cells and macrophages. First, Stat3 is directly recruited to two redundant YXXQ sequences in the intracellular domain of the IL-10 receptor following ligand binding (18Weber-Nordt R.M. Riley J.K. Greenlund A.C. Moore K.W. Darnell J.E. Schreiber R.D. J. Biol. Chem. 1996; 271: 27954-27961Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 22Stahl N. Farrugglella T.J. Boulton T.G. Zhong Z. Darnell Jr., J.E. Yancopoulos G.D. Science. 1995; 267: 1349-1353Crossref PubMed Scopus (869) Google Scholar). Receptor mutants lacking these two sequences fail to activate Stat3 and fail to promote a variety of IL-10-dependent responses when expressed in the Ba/F3 pro-B cell line (16Ho A.S.-Y. Wei S.H.-Y. Mui A.L.-F. Miyajima A. Moore K.W. Mol. Cell. Biol. 1995; 15: 5043-5053Crossref PubMed Scopus (102) Google Scholar, 18Weber-Nordt R.M. Riley J.K. Greenlund A.C. Moore K.W. Darnell J.E. Schreiber R.D. J. Biol. Chem. 1996; 271: 27954-27961Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). Second, overexpression of a dominant-negative Stat3 mutant protein in the J774 murine macrophage cell line inhibited IL-10-dependent antiproliferative responses and partially blocked IL-10-induced expression of the CD32/16 Fcγ receptor (23O'Farrell A.M. Liu Y. Moore K.W. Mui A.L.F. EMBO J. 1998; 17: 1006-1018Crossref PubMed Scopus (372) Google Scholar). Importantly, these latter developmental responses are also effected by other cytokines that activate Stat3, such as IL-6. However, these same studies failed to find a blocking effect of mutant Stat3 proteins on the anti-inflammatory actions of IL-10. Thus, the existing data suggest either that the IL-10 receptor utilizes different signaling mechanisms to manifest anti-inflammatory versus developmental effects or that different IL-10-induced biologic responses in cells display differential requirements for Stat3 activation. Herein we demonstrate that macrophages derived from mice engineered to express a genetic Stat3 deficiency in the myeloid cell compartment fail to respond to IL-10 and secrete high levels of TNFα upon stimulation with IL-10 plus LPS. These results thus unequivocally establish the requirement of Stat3 for the anti-inflammatory functions of IL-10 in primary cells. Using gain-of-function and loss-of-function receptor mutants, we also define the functionally critical regions on the IL-10 receptor that regulate developmental versusanti-inflammatory functions of this cytokine. The developmental functions map to IL-10 receptor regions that are critical for Stat3 recruitment and that are shared by receptors for other cytokines that activate Stat3, such as IL-6. In contrast, the anti-inflammatory function of IL-10 displays the additional requirement for a carboxyl-terminal 30-amino acid sequence in the intracellular domain of the receptor that contains at least one functionally important serine residue. Thus, the unique anti-inflammatory functions of IL-10 can be explained by distinctive receptor intracellular domain sequences that are not shared by other Stat3 activating cytokine receptors. Recombinant murine IL-10 was generated as described previously (24Weber-Nordt R.M. Meraz M.A. Schreiber R.D. J. Immunol. 1994; 153: 3734-3744PubMed Google Scholar). Purified recombinant human and murine IFNγ were generously provided by Genentech, Inc. (South San Francisco, CA). Purified recombinant murine IL-3 and IL-6 were purchased from Genzyme (Cambridge, MA). M-CSF were obtained from R&D Systems (Minneapolis, MN). Lipopolysaccharide (LPS) derived from Escherichia coli0127:B8 was purchased from Difco (Detroit, MI). GIR-208 is a murine IgG1 monoclonal antibody specific for the human IFNγ receptor (25Sheehan K.C.F. Calderon J. Schreiber R.D. J. Immunol. 1988; 140: 4231-4237PubMed Google Scholar), and 9E10 is a murine IgG1 monoclonal antibody specific for a 13-amino acid peptide tag derived from the human c-Myc protein (SMEQKLISEEDLN) (26Evan G.I. Lewis G.K. Ramsay G. Bishop J.M. Mol. Cell. Biol. 1985; 5: 3610-3616Crossref PubMed Scopus (2166) Google Scholar). These two antibodies were purified and conjugated to biotin using the Enzo biotinylating reagent (Enzo Biochem, Inc.) as described (25Sheehan K.C.F. Calderon J. Schreiber R.D. J. Immunol. 1988; 140: 4231-4237PubMed Google Scholar). The primers listed below were synthesized on an Oligo 1000 DNA synthesizer (Beckman, Fullerton, CA) and were based on the nucleotide sequence of either the human IFNγ cDNA (27Aguet M. Dembic Z. Merlin G. Cell. 1988; 55: 273-280Abstract Full Text PDF PubMed Scopus (373) Google Scholar) or the murine IL-10 receptor cDNA (11Ho A.S.Y. Liu Y. Khan T.A. Hsu D.-H. Bazan J.F. Moore K.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11267-11271Crossref PubMed Scopus (218) Google Scholar): primer 100741, 5′-AACATACAGAAGAACTTTCTAG-3′; primer 100341, 5′-CCTGGAATGTCACCATGACGGCTTTTATTACGGTTATGAG-3′; primer 100242, 5′-CTCATAACCGTAATAAAAGCCGTCATGGTGACATTCCAGG-3′; primer 100141, 5′-CATGCCAAGCTTCTAGATTATTCTTCTACCTGCAGGC-3′; primer 5393, 5′-GTCTGTTTCTGGAAGCCCTGGAATGTCACC-3′; primer 5394, 5′-TTCCAGGGCTTCCAGAAACAGACCAGATGG-3′; primer 5395, 5′-CTCCTGTTTCAAGAAACCTGCGGCCAGAGC-3′; primer 5396, 5′-TGGCCGCAGGTTTCTTGAAACAGGAGTCTC-3′; primer 38436, 5′-CATGCCAAGCTTCTAGATTAAGAGCCAAGGCTATCCAGG-3′; primer 38437, 5′-CATGCCAAGCTTCTAGATTACAGAGGGTCAAGTTTATGG-3′; primer 38438, 5′-CATGCCAAGCTTCTAGATTAATCTTCACAGCTAACCACACC-3′; primer 38439, 5′-CATGCCAAGCTTCTAGATTATTGATTCCACTGTCTACTTGG-3′ and primer 373356, 5′-TACCCAAGCTTGGGTCATTCTT CTACCTGCAGGGCGGCGATCAACGGCAGGGTGACCAGGTTAGCGCCAAGGGCATCCAGGAGGCC-3′. Plasmids were constructed using standard procedures (28Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 1.1-1.8Google Scholar). The hgrα/IL-10Rα chimeric receptor (hgrα1–434aa/muIL-10Rα420–559aa) was created through the use of a two-step polymerase chain reaction as described previously (29Farrar M.A. Campbell J.D. Schreiber R.D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 11706-11710Crossref PubMed Scopus (88) Google Scholar). Primers 100741 and 100141 were used as the 5′-and 3′-primers, whereas primers 100341 and 100242 were the internal primers used to generate the chimeric receptor. The chimeric receptor point mutants (hgrα/IL-10RαY427F, hgrα/IL-10RαY477F, and hgrα/IL-10RαY427F/Y477F) were also generated through the use of a two-step polymerase chain reaction. All chimeric receptor point mutants utilized primers 100741 and 100141 as the 5′- and 3′-primers. hgrα/IL-10RαY427F was constructed using primers 5393 and 5394 as the internal primers. hgrα/IL-10RαY477F was created using internal primers 5395 and 5396. In both cases, a Bluescript plasmid (Stratagene, La Jolla, CA) that contained the wild type hgrα/IL-10Rα chimeric receptor was used as template. hgrα/IL-10RαY427F/Y477F was generated using internal primers 5395 and 5396. A Bluescript plasmid that contained hgrα/IL-10RαY427F was used as template. We generated a series of hgrα/IL-10Rα chimeric receptor truncation mutants by serially truncating 15 amino acids from the carboxyl terminus of the wild type hgrα/IL-10Rα chimeric receptor. All of the receptor truncation mutants were generated using primer 100741 as the 5′-primer. The 3′-primers used to construct hgrα/IL-10RαΔ1–4 were 38436, 38437, 38438, and 38439 respectively. The chimeric receptor serine to alanine mutant (hgrα/IL-10RαS541A/S544A/S553A/S554A) was generated using primers 100741 and 373356 as the 5′- and 3′-primers, respectively. All previously described constructs were digested withSmaI/HindIII and subcloned into a Bluescript plasmid that contained the wild type human IFNγ receptor α chain digested with the same enzymes. All constructs were then subcloned into the pSRα expression vector. The accuracy of all polymerase chain reaction-generated DNA was confirmed by automated sequencing (Perkin-Elmer Corp.). RAW264.7 cells, a murine monocyte-macrophage cell line, were obtained from American Type Culture Collection (Manassas, VA) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 2%l-glutamine, 1 mm sodium pyruvate, 50 units/ml penicillin, and 50 μg/ml streptomycin. Ba/F3 cells, a murine pro-B cell line, were generously provided by Kevin Moore (DNAX, Palo Alto, CA) and maintained in RPMI 1640 medium supplemented with 10% fetal calf serum, 1% l-glutamine, 1 mm sodium pyruvate, 50 units/ml penicillin, 50 μg/ml streptomycin, and 10 ng/ml muIL-3. Primary macrophages derived from fetal liver or bone marrow were prepared using CSF-1 as described (21Rodig S.J. Meraz M.A. White J.M. Lampe P.A. Riley J.K. Arthur C.D. King K.L. Sheehan K.C.F. Yin L. Pennica D. Johnson E.M. Schreiber R.D. Cell. 1998; 93: 373-383Abstract Full Text Full Text PDF PubMed Scopus (671) Google Scholar). Cells were then placed in culture for two days in D-10 supplemented with 5% heat inactivated horse serum. Bone marrow macrophages derived from Stat3-deficient mice were >99% positive for MAC-1 and Fcγ receptor as determined by flow cytometry. Cells (1 × 107) were transfected with 50 μg of plasmid by electroporation at 320 V and 960 μF (RAW264.7 cells) or at 400 V and 960 μF (Ba/F3 cells) on a Bio-Rad gene pulser. Cotransfections were carried out using 5 μg of the pMon1118 plasmid (hygromycin resistance) and 45 μg of the expression plasmid. Selection with G418 and hygromycin B was begun 48 h after transfection. After selection was completed, cells were sorted based on their expression of both the hgrα/IL-10Rα chimeric receptor and the human IFNγ receptor β chain. Cell lines were subsequently cloned by limiting dilution. Similar results were obtained with bulk-transfected populations. Both RAW264.7 and Ba/F3 cells were stably transfected with a plasmid (pSRα, which confers neomycin resistance) (30Bach E.A. Tanner J.W. Marsters S.A. Ashkenazi A. Aguet M. Shaw A.S. Schreiber R.D. Mol. Cell. Biol. 1996; 16: 3214-3221Crossref PubMed Scopus (126) Google Scholar) encoding the wild type human IFNγ receptor β chain (tagged at the amino terminus with a 13-amino acid peptide derived from c-Myc) (30Bach E.A. Tanner J.W. Marsters S.A. Ashkenazi A. Aguet M. Shaw A.S. Schreiber R.D. Mol. Cell. Biol. 1996; 16: 3214-3221Crossref PubMed Scopus (126) Google Scholar). These cells were then stably transfected with a plasmid encoding either wild type or mutant forms of the hgrα/IL-10Rα chimeric receptor and the plasmid pMON1118, which confers hygromycin resistance (30Bach E.A. Tanner J.W. Marsters S.A. Ashkenazi A. Aguet M. Shaw A.S. Schreiber R.D. Mol. Cell. Biol. 1996; 16: 3214-3221Crossref PubMed Scopus (126) Google Scholar). RAW264.7 cells transfected with different forms of the chimeric receptor and the human IFNγ receptor β chain were selected on G418 (Life Technologies, Inc., 1.0 mg/ml active compound) and 0.5 mg/ml of hygromycin B (Calbiochem). Ba/F3 cells transfected with receptor constructs were selected using G418 (1.0 mg/ml active compound) and 1.3 mg/ml hygromycin B. Flow cytometry for the hgrα/IL-10Rα chimeric receptor and receptor mutants or the human IFNγ receptor β chain was conducted using the biotinylated forms of GIR-208 (anti-human IFNγ receptor) and 9E10 (anti-c-Myc peptide) respectively and streptavidin-phycoerythrin conjugate (Chromoprobe, Redwood City, CA) as described (31Farrar M.A. Fernandez-Luna J. Schreiber R.D. J. Biol. Chem. 1991; 266: 19626-19635Abstract Full Text PDF PubMed Google Scholar). Cells were analyzed on a Becton Dickinson FACScan. Cells (5 × 106) were washed once and then resuspended in 500 μl of medium. 1000 units/ml murine or human IFNγ or 200 ng/ml muIL-10 was added to the cells and incubated for 7 min at 37 °C. The cells were analyzed by electrophoretic mobility shift assay as described previously (32Greenlund A.C. Farrar M.A. Viviano B.L. Schreiber R.D. EMBO J. 1994; 13: 1591-1600Crossref PubMed Scopus (376) Google Scholar) using an 18-base pair oligonucleotide probe that contained the gamma response region of the FcγRI gene. Ba/F3 cells were washed twice in supplemented RPMI 1640 medium that lacked muIL-3. The cells were seeded in a 96-well plate at a density of 2 × 104 cells/well and rested for 3 h in the absence of muIL-3. The cells were then incubated with varying amounts of huIFNγ or muIL-10 in a total volume of 150 μl of medium. Cells were incubated for 48 h at 37 °C and an 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay was performed as described previously (33Traversari C. van der Bruggen P. Van den Eynde B. Hainaut P. Lemoine C. Ohta N. Old L. Boon T. Immunogenetics. 1992; 35: 145-152Crossref PubMed Scopus (185) Google Scholar). Experiments were performed at least three times using multiple clones of each transfected cell line. Similar results were obtained using transfected bulk populations. RAW264.7 cells were washed once, seeded in 96-well plates at a density of 5 × 104 cells/well, and incubated with varying amounts of huIFNγ, muIL-6, or muIL-10 in a total volume of 150 μl supplemented Dulbecco's modified Eagle's medium. Cells were incubated for 1 h at 37 °C and then treated with 10 ng of LPS/well. The cells were placed at 37 °C for 24 h, at which point the culture supernatants were harvested, and TNFα levels were quantitated via a TNFα ELISA (34Sheehan K.C.F. Ruddle N.H. Schreiber R.D. J. Immunol. 1989; 142: 3884-3893PubMed Google Scholar). Experiments were performed at least three times using multiple clones of each transfected cell line. Similar results were obtained using transfected bulk populations. Peritoneal exudate cells (5 × 104) derived from naive female BALB/c ByJ mice were plated in each well of a 96-well tissue culture plate. Cells were allowed to adhere for 3 h. Adherent peritoneal exudate cells were then washed twice with warm medium and treated as described above. Macrophages derived from Stat3-, Stat1-, and Jak1-deficient mice were cultured as described above. Cells were incubated with different doses of muIL-10 for 12 h. LPS was added at a final concentration of 2 μg/ml, and the cells were cultured for and additional 24 h. Culture supernatants were harvested, and TNFα levels were quantitated via a TNFα ELISA. To determine whether Stat3 is required for the anti-inflammatory actions of IL-10, we monitored the ability of this cytokine to inhibit LPS-induced TNFα production in macrophages derived from mice with a genetic deficiency of Stat3 targeted to myeloid cells (35Takeda K. Clausen B.E. Kaisho T. Tsujimura T. Terada N. Forster I. Akira S. Immunity. 1999; 10: 39-49Abstract Full Text Full Text PDF PubMed Scopus (1040) Google Scholar). IL-10 treatment of wild type macrophages resulted in a dose-dependent inhibition of LPS-induced TNFα production that reached maximal levels at a 1 ng/ml dose of IL-10 (Fig.1). In contrast, macrophages derived from mice with a myeloid cell Stat3 deficiency were unable to inhibit LPS-induced TNFα production at any dose of IL-10 used. As additional controls, macrophages from Jak1−/− and Stat1−/− mice were also tested in these experiments for IL-10 sensitivity (21Rodig S.J. Meraz M.A. White J.M. Lampe P.A. Riley J.K. Arthur C.D. King K.L. Sheehan K.C.F. Yin L. Pennica D. Johnson E.M. Schreiber R.D. Cell. 1998; 93: 373-383Abstract Full Text Full Text PDF PubMed Scopus (671) Google Scholar, 36Harpur A.G. Andres A.C. Ziemiecki A. Aston R.R. Wilks A.F. Oncogene. 1992; 7: 1347-1353PubMed Google Scholar). In agreement with our previous reports (20Meraz M.A. White J.M. Sheehan K.C.F. Bach E.A. Rodig S.J. Dighe A.S. Kaplan D.H. Riley J.K. Greenlund A.C. Campbell D. Carver-Moore K. DuBois R.N. Clark R. Aguet M. Schreiber R.D. Cell. 1996; 84: 431-442Abstract Full Text Full Text PDF PubMed Scopus (1401) Google Scholar,21Rodig S.J. Meraz M.A. White J.M. Lampe P.A. Riley J.K. Arthur C.D. King K.L. Sheehan K.C.F. Yin L. Pennica D. Johnson E.M. Schreiber R.D. Cell. 1998; 93: 373-383Abstract Full Text Full Text PDF PubMed Scopus (671) Google Scholar), Jak1−/− macrophages were unresponsive to IL-10, whereas the IL-10 response in Stat1−/− macrophages was indistinguishable from that of wild type mice. Thus, Stat3, together with Jak1, is obligatorily required for IL-10-dependent inhibition of TNFα production in LPS-stimulated macrophages. Whereas these results demonstrated that Stat3 was required for mediating the anti-inflammatory actions of IL-10, they did not reveal whether it was sufficient to induce these functions. To address this issue, we compared the anti-inflammatory action of IL-10 to that of IL-6, a cytokine that utilizes a distinct receptor system but that also activates Stat3 and Jak1. Pretreatment of RAW264.7 cells with increasing doses of IL-10 resulted in a dose-dependent inhibition of TNFα production, reaching a maximal level of 75% at a dose of 200 ng of the cytokine (Fig.2 A). In contrast, RAW264.7 cells pretreated with IL-6 were only slightly inhibited in their ability to produce TNFα (maximal level of inhibition, 30% at a 200-ng dose of IL-6). We also compared the anti-inflammatory effects of IL-10 and IL-6 on primary murine macrophages. Here again, whereas IL-10 displayed potent inhibitory activity on TNFα production, IL-6 did not (Fig. 2 B). These functional differences could not be ascribed to different levels of Stat3 activation because the kinetics and ultimate magnitude of Stat3 activated by IL-10 and IL-6 in either RAW264.7 cells or primary macrophages was identical (data not shown). Thus, the JAK-STAT pathway is required but not sufficient for IL-10-dependent inhibition of LPS-induced TNFα production. To identify functionally critical amino acid residues within the intracellular domain of the muIL-10 receptor ligand binding chain involved in mediating the anti-inflammatory versus developmental effects of IL-10, we generated a chimeric receptor that consisted of the human IFNγ receptor α chain extracellular and transmembrane domains and the first 184 amino acids of the intracellular domain (i.e.truncated just above the Stat1 docking site) attached to a 140-amino acid region of the murine IL-10 receptor carboxyl terminus, which contains the Stat3 docking sites (Fig.3). The resulting chimeric receptor thus consists of the human IFNγRα chain that retained the Jak1 binding site and lacked the Stat1 docking site but now contained the two redundant IL-10 receptor Stat3 docking sites. The chimeric polypeptide was then expressed in murine RAW264.7 macrophages or Ba/F3 pro-B cells that had been engineered to also stably express the human IFNγ receptor β chain (Table I).Table IExpression levels of wild type and mutant hgrα/IL-10Rα chimeric receptors on RAW264.7 and BaF3 cellsChimeric receptorSubunit expression (mean channel shift)RAW264.7Ba/F3α chainβ chainα chainβ chainhgrα/IL-10Rα27.19.8216.58.0hgrα/IL-10RαY427F23.237.212.217.3hgrα/IL-10RαY477F47.55.717.110.3hgrα/IL-10RαY427F/Y477F22.230.610.216.9hgrα/IL-10RαΔ123.627.619.717.2hgrα/IL-10RαΔ215.038.416.811.3hgrα/IL-10RαΔ319.025.714.610.0hgrα/IL-10RαΔ419.333.421.210.0hgrα/IL-10RαS541A/S544A/S553A/S554A16.225.5 Open table in a new tab Engagement of the endogenous IL-10 receptor on RAW264.7 cells with muIL-10 led to a dose-dependent inhibition of TNFα production in LPS-treated cells (Fig.4 A). HuIFNγ has no effect on these cells because of the strict species specificity that governs the interaction of IFNγ with its receptor. Treatment of RAW264.7 cells expressing the hgrα/IL-10Rα chimeric receptor with human IFNγ induced a dose-dependent inhibition of LPS-dependent TNFα production in a manner that was quantitatively identical to that induced by the activated, endogenous IL-10 receptor. In contrast, treatment of wild type or transfected RAW264.7 cells with murine IFNγ caused a dose-dependent increase of TNFα production (data not shown). In a similar manner, Ba/F3 engineered to express the wild type muIL-10 receptor proliferated in the presence of muIL-10 (Fig. 4 B) but did not respond to human IFNγ. In contrast, Ba/F3 cells bearing the hgrα/IL-10Rα chimeric receptor proliferated upon exposure to human IFNγ. Thus, transfer of IL-10 receptor sequences containing the Stat3 recruitment sites to the IFNγ receptor results in the generation of a modified IFNγ receptor that promotes IL-10-dependent rather than IFNγ-dependen
.jpg){kind=small}
Discussion(0)
No comments yet. Be the first to comment.