Inhibition of Protein Translocation across the Endoplasmic Reticulum Membrane by Sterols

Cholesterol and related sterols are known to modulate the physical properties of biological membranes and can affect the activities of membrane-bound protein complexes. Here, we report that an early step in protein translocation across the endoplasmic reticulum (ER) membrane is reversibly inhibited by cholesterol levels significantly lower than those found in the plasma membrane. By UV-induced chemical cross-linking we further show that high cholesterol levels prevent cross-linking between ribosome-nascent chain complexes and components of the Sec61 translocon, but have no effect on cross-linking to the signal recognition particle. The inhibiting effect on translocation is different between different sterols. Our data suggest that the protein translocation machinery may be sensitive to changes in cholesterol levels in the ER membrane. Cholesterol and related sterols are known to modulate the physical properties of biological membranes and can affect the activities of membrane-bound protein complexes. Here, we report that an early step in protein translocation across the endoplasmic reticulum (ER) membrane is reversibly inhibited by cholesterol levels significantly lower than those found in the plasma membrane. By UV-induced chemical cross-linking we further show that high cholesterol levels prevent cross-linking between ribosome-nascent chain complexes and components of the Sec61 translocon, but have no effect on cross-linking to the signal recognition particle. The inhibiting effect on translocation is different between different sterols. Our data suggest that the protein translocation machinery may be sensitive to changes in cholesterol levels in the ER membrane. endoplasmic reticulum acyl-coenzyme A:cholesterol acyltransferase 4-cholesten-3β-ol 4-cholesten-3-one 5-cholesten-3β-ol methyl-β-cyclodextrin 5α-cholestan-3β-ol 7(5α)-cholesten-3β-ol 8(14)-cholesten-3β-ol Nε-(5-azido-2-nitrobenzoyl)lysine ribosome-nascent chain complex signal recognition particle polyacrylamide gel electrophoresis protein preprolactin Sterols are known to modulate the physical properties of biological membranes (1Yeagle P.L. Biochim. Biophys. Acta. 1985; 822: 267-287Crossref PubMed Scopus (1249) Google Scholar, 2Yeagle P.L. Yeagle P.L. Biology of Cholesterol. CRC Press Inc., Boca Raton, FL1988: 121-146Google Scholar, 3Finegold L. Cholesterol in Membrane Models. CRC Press Inc., Boca Raton, FL1993Google Scholar, 4Simons K. Ikonen E. Science. 2000; 290: 1721-1726Crossref PubMed Scopus (1066) Google Scholar). In particular, cholesterol increases the orientational order and reduces the rate of motion of the phospholipid hydrocarbon chains (1Yeagle P.L. Biochim. Biophys. Acta. 1985; 822: 267-287Crossref PubMed Scopus (1249) Google Scholar, 2Yeagle P.L. Yeagle P.L. Biology of Cholesterol. CRC Press Inc., Boca Raton, FL1988: 121-146Google Scholar, 3Finegold L. Cholesterol in Membrane Models. CRC Press Inc., Boca Raton, FL1993Google Scholar) and decreases the effective free volume in the membrane (5Straume M. Litman B.J. Biochemistry. 1987; 26: 5121-5126Crossref PubMed Scopus (119) Google Scholar). The induced changes in membrane properties can help to modulate the activity of membrane-resident proteins, in addition to more specific protein regulation mechanisms (2Yeagle P.L. Yeagle P.L. Biology of Cholesterol. CRC Press Inc., Boca Raton, FL1988: 121-146Google Scholar, 6Yeagle P.L. Biochimie (Paris). 1991; 73: 1303-1310Crossref PubMed Scopus (293) Google Scholar). Cholesterol can further affect the function of individual proteins by direct binding (7Murata M. Peranen J. Schreiner R. Wieland F. Kurzchalia T.V. Simons K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10339-10343Crossref PubMed Scopus (765) Google Scholar, 8Osborne T.F. Rosenfeld J.M. Curr. Opin. Lipidol. 1998; 9: 137-140Crossref PubMed Scopus (40) Google Scholar, 9Lange Y. Steck T.L. Curr. Opin. Struct. Biol. 1998; 8: 435-439Crossref PubMed Scopus (34) Google Scholar). Since cholesterol increases the lipid chain order, the insertion of cholesterol leads to a laterally more condensed membrane (1Yeagle P.L. Biochim. Biophys. Acta. 1985; 822: 267-287Crossref PubMed Scopus (1249) Google Scholar, 2Yeagle P.L. Yeagle P.L. Biology of Cholesterol. CRC Press Inc., Boca Raton, FL1988: 121-146Google Scholar, 3Finegold L. Cholesterol in Membrane Models. CRC Press Inc., Boca Raton, FL1993Google Scholar, 4Simons K. Ikonen E. Science. 2000; 290: 1721-1726Crossref PubMed Scopus (1066) Google Scholar). Cholesterol/sphingolipid rafts and caveolae in the plasma membranes are good examples of such tightly packed, laterally segregated cholesterol-rich domains (4Simons K. Ikonen E. Science. 2000; 290: 1721-1726Crossref PubMed Scopus (1066) Google Scholar, 10Simons K. Ikonen E. Nature. 1997; 387: 569-572Crossref PubMed Scopus (8092) Google Scholar, 11Brown D.A. London E. J. Biol. Chem. 2000; 275: 17221-17224Abstract Full Text Full Text PDF PubMed Scopus (2056) Google Scholar). Raft-like structures have also been suggested to exist in the Golgi and in the endocytic pathway, while the endoplasmic reticulum (ER)1 and other internal membranes are devoid of rafts (12Brown D.A. London E. J. Membr. Biol. 1998; 164: 103-114Crossref PubMed Scopus (836) Google Scholar). Cholesterol levels differ markedly between different cellular membranes. The cholesterol concentration is low in the ER and increases throughout the secretory pathway. Most of the cellular cholesterol is found in the plasma membrane (13Lange Y. Swaisgood M.H. Ramos B.V. Steck T.L. J. Biol. Chem. 1989; 264: 3786-3793Abstract Full Text PDF PubMed Google Scholar, 14Van Meer G. Annu. Rev. Cell Biol. 1989; 5: 247-275Crossref PubMed Scopus (349) Google Scholar, 15Lange Y. J. Lipid Res. 1991; 32: 329-339Abstract Full Text PDF PubMed Google Scholar, 16Liscum L. Munn N.J. Biochim. Biophys. Acta. 1999; 1438: 19-37Crossref PubMed Scopus (291) Google Scholar). The fact that the ER membrane contains only small amounts of cholesterol (13Lange Y. Swaisgood M.H. Ramos B.V. Steck T.L. J. Biol. Chem. 1989; 264: 3786-3793Abstract Full Text PDF PubMed Google Scholar, 17Lange Y. Strebel F. Steck T.L. J. Biol. Chem. 1993; 268: 13838-13843Abstract Full Text PDF PubMed Google Scholar, 18Lange Y. Steck T.L. J. Biol. Chem. 1997; 272: 13103-13108Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) is quite amazing, since it is the site of cholesterol biosynthesis, esterification, and regulation (19Reinhart M.P. Billheimer J.T. Faust J.R. Gaylor J.L. J. Biol. Chem. 1987; 262: 9649-9655Abstract Full Text PDF PubMed Google Scholar, 20Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1103) Google Scholar). All of the regulatory proteins residing in the ER respond to changes in the local cholesterol level. Changes in plasma membrane cholesterol are reflected in the ER cholesterol levels, allowing feedback control of cholesterol synthesis and esterification in the ER (20Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1103) Google Scholar, 21Lange Y. Steck T.L. J. Biol. Chem. 1994; 269: 29371-29374Abstract Full Text PDF PubMed Google Scholar, 22Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (2980) Google Scholar). Given that membrane-bound ER resident enzymes normally function in a cholesterol-poor environment, they may be expected to be particularly sensitive to increases in cholesterol levels. Here we report that an early step in protein translocation across the ER membrane is reversibly inhibited by cholesterol levels significantly lower than those found in the plasma membrane. We have also examined whether a change in cholesterol double bond position or number affects protein translocation. 5α-Cholestan-3β-ol (dihydrocholesterol) and 4-cholesten-3β-ol (allocholesterol) inhibit protein translocation, whereas 4-cholesten-3-one (cholestenone), 7(5α)-cholesten-3β-ol (lathosterol), and 8(14)-cholesten-3β-ol (8-sterol) have no apparent effects. By UV-induced chemical cross-linking we further show that high cholesterol levels prevent cross-linking between ribosome-nascent chain complexes (RNCs) and components of the Sec61 translocon, but have no effect on cross-linking of RNCs to the signal recognition particle (SRP). These observations suggest that an increase in membrane stiffness renders the Sec61 protein translocation machinery in the ER unable to recognize and/or initiate translocation of nascent polypeptide chains. One possible implication of our findings is that Sec61 translocons that have leaked out to the Golgi compartment and beyond (23Greenfield J. High S. J. Cell Sci. 1999; 112: 1477-1486Crossref PubMed Google Scholar) may be rendered nonfunctional by cholesterol-mediated inhibition. Unless otherwise stated, all enzymes, plasmid pGEM1, and rabbit reticulocyte lysate were from Promega (Madison, WI) or New England Biolabs (Boston, MA). T7 DNA polymerase, [35S]Met, 14C-methylated marker proteins, ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, the cap analogues m7G(5′)ppp(5′)G and G(5′)ppp(5′)G, and [14C]oleoyl-coenzyme A (56 mCi/mmol) were from Amersham Pharmacia Biotech (Uppsala, Sweden and Piscataway, NJ). Protein A-Sepharose, puromycin, and 7-methylguanosine 5′-monophosphate were from Sigma. Affinity-purified rabbit antisera to the C-terminal 13 amino acids of TRAM were obtained from Research Genetics (Huntsville, AL). Most of the sterols used and methyl-β-cyclodextrin were obtained from Sigma. Allocholesterol was purchased from Steraloids (Newport, RI) and 8-sterol from Research Plus Inc. (Bayonne, NJ). The purity of all sterols was examined by reversed phase high performance liquid chromatography, and all, except for dihydrocholesterol, were 99% pure and were used without further purification. Dihydrocholesterol was purified by crystallization in ethanol-water at −20 °C overnight and was shown to be 99% pure by reversed phase high performance liquid chromatography. Dog pancreas microsomes were prepared as described in Ref. 24Walter P. Blobel G. Methods Enzymol. 1983; 96: 84-93Crossref PubMed Scopus (476) Google Scholar. Site-specific mutagenesis was performed according to the method of Kunkel (25Kunkel T.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar, 26Geisselsoder J. Witney F. Yuckenberg P. BioTechniques. 1987; 5: 786-791Google Scholar). All mutants were confirmed by sequencing of plasmid DNA. All cloning steps were done according to standard procedures. For cloning into and expression of Lep from the pGEM1 plasmid, the 5′ end of the lep gene was modified, first, by the introduction of an XbaI site and, second, by changing the context 5′ to the initiator ATG codon to a “Kozak consensus” sequence (27Kozak M. Mol. Cell. Biol. 1989; 9: 5073-5080Crossref PubMed Scopus (374) Google Scholar). Thus, the 5′ region of the gene was modified to: … ATAACCCTCTAGAGCCACCATGGCGAAT … (XbaI site and initiator codon underlined). Mutants of Lep were cloned into pGEM1 behind the SP6 promoter as an XbaI-SmaI fragment. DNA template for in vitrotranscription of full-length Lep mRNA was prepared by transcription of the Lep-pGEM1 plasmid with SP6 RNA polymerase for 1 h at 37 °C. The transcription mixture was as follows: 1–5 μg of DNA template, 5 μl of 10× SP6 H-buffer (400 mm Hepes-KOH pH 7.4, 60 mm magnesium acetate, 20 mm spermidine HCl), 5 μl of bovine serum albumin (1 μg/μl), 5 μl of m7G(5′)ppp(5′)G (10 mm), 5 μl of dithiothreitol (50 mm), 5 μl of NTP mix (10 mm ATP, 10 mm CTP, 10 mm UTP, 5 mm GTP), 18.5 μl of H2O, 1.5 μl of RNase inhibitor (40 units/μl), 0.5 μl of SP6 RNA polymerase (20 units/μl). Translation of 1 μl of Lep mRNA in 9 μl of nuclease-treated reticulocyte lysate, 1 μl of RNase inhibitor (40 units/μl), 1 μl of [35S]Met (10 μCi/μl), 1 μl of amino acids mix (1 mm concentration of each amino acid except Met), 1 μl of mRNA, 1 μl of dog pancreas microsomes (2 units/μl; one unit is defined as the amount of microsomes required for 50% translocation of in vitro synthesized preprolactin) was performed as described in Ref. 28Liljeström P. Garoff H. J. Virol. 1991; 65: 147-154Crossref PubMed Google Scholar at 30 °C for 1 h. Template for in vitro transcription of truncated Lep mRNA was prepared using PCR to amplify a fragment from the Lep-pGEM1 plasmid. The 5′ primer was situated 210 bases upstream of the translation start, and the amplified fragment thus contained the SP6 transcriptional promoter from pGEM1. The 3′ primer was chosen to produce a truncated fragment ending at codon 271 in Lep, and no stop codon was included. Translation/translocation reactions of truncated Lep mRNA for puromycin treatment (Fig. 3, panel B) were performed at 22 °C in a total volume of 14 μl. When relevant, 3.5 μg of cholesterol (0.23 μg/μl) was added after 25-min translation. After an additional 10-min incubation, 1.9 μl of potassium acetate (4 m), 1.5 μl of magnesium acetate (20 mm), and 1.5 μl of puromycin (30 mm) were added, and the incubation was continued at 22 °C for another 10 min. For alkali extraction, a 10-μl translation mix was diluted with 90 μl of ice-cold 0.1 m Na2CO3/NaOH, pH 11.5, and the samples were centrifuged for 10 min at 70,000 rpm in a Beckman tabletop 100.3 rotor. Before SDS-PAGE, the supernatants were precipitated with trichloroacetic acid, and all samples were heated at 95 °C for 5 min. Proteins were analyzed by SDS-PAGE, and gels were visualized on a Fuji FLA-3000 phosphoimager using the Fuji Image Reader 8.1j software. mRNA coding for truncated preprolactin polypeptide was synthesized by in vitro transcription using linearized pSPBP4 DNA and SP6 RNA polymerase as described previously (29Do H. Falcone D. Lin J. Andrews D.W. Johnson A.E. Cell. 1996; 85: 369-378Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). The PvuII restriction site (after codon 86) was chosen to obtain a run-off transcript encoding the N-terminal 86 residues of preprolactin. In vitro translation for photolysis (25 μl total volume) and immunoprecipitation (50 μl total volume) were done in wheat germ cell-free extract (29Do H. Falcone D. Lin J. Andrews D.W. Johnson A.E. Cell. 1996; 85: 369-378Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar, 30Liao S. Lin J. Do H. Johnson A. Cell. 1997; 90: 31-41Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar) in the presence of 40 nm canine SRP, 8 equivalents (16 equivalents for immunoprecipitation) of column-washed rough microsomes (24Walter P. Blobel G. Methods Enzymol. 1983; 96: 84-93Crossref PubMed Scopus (476) Google Scholar), [35S]Met (5 μCi for cross-linking, 100 μCi for immunoprecipitation), and 15 pmol of εANB-Lys-tRNA (29Do H. Falcone D. Lin J. Andrews D.W. Johnson A.E. Cell. 1996; 85: 369-378Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). Photoreactive Nε-(5-azido-2-nitrobenzoyl)-Lys-tRNA (εANB-Lys-tRNA) was prepared as detailed previously (31Krieg U.C. Walter P. Johnson A.E. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 8604-8608Crossref PubMed Scopus (238) Google Scholar). Samples were photolysed on ice for 15 min using a 500-watt mercury arc lamp (29Do H. Falcone D. Lin J. Andrews D.W. Johnson A.E. Cell. 1996; 85: 369-378Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). After photolysis, membranes or ribosomes were sedimented through a sucrose cushion in a Beckman airfuge at 4 °C for 5 min, 20 p.s.i. and 60 min, 30 p.s.i., respectively. Microsome and ribosome pellets were resuspended in buffer (100 mm Tris-HCl, pH 7.6) containing detergent (0.25% w/v SDS for Sec61α- and Sec61β-specific antibodies and 1% w/v SDS for TRAM- and SRP54-specific antibodies) and placed at 55 °C for a minimum of 30 min. The volume was increased with buffer A (140 mm NaCl, 10 mm Tris-HCl, pH 7.6, 2% v/v Triton X-100, 0.2% w/v SDS) for Sec61α and Sec61β antibodies and buffer B (150 mm NaCl, 50 mm Tris-HCl, pH 7.6, 2% (v/v) Triton X-100, 0.2% SDS) for TRAM and SRP54 antibodies. Samples were then precleared by rocking with protein A-Sepharose at room temperature for 1 h before the Sepharose beads were removed by sedimentation. Sec61α-, Sec61β-, TRAM-, or SRP54-specific antiserum was added to each supernatant, and the samples were rocked overnight at 4 °C. Protein A-Sepharose was then added to each sample and incubated for a minimum of 2 h at 4 °C. The immunoprecipitated proteins were analyzed by SDS-PAGE and visualized using a Bio-Rad GS-250 phosphorimager (29Do H. Falcone D. Lin J. Andrews D.W. Johnson A.E. Cell. 1996; 85: 369-378Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). To enrich the microsomes with cholesterol or sterol analogues, complexes between methyl-β-cyclodextrin (CyD) and sterols were prepared by a slight modification of the procedure described in Ref. 32Christian A.E. Haynes M.P. Phillips M.C. Rothblat G.H. J. Lipid Res. 1997; 38: 2264-2272Abstract Full Text PDF PubMed Google Scholar. 32 mg of CyD was dissolved in 1 ml of MS buffer (0.25 m sucrose, 20 mm Hepes-KOH, pH 7.5), and this solution was added to a thin film of sterol (1 mg) in a tube. The molar ratio of sterol to CyD was 1/10. The mixture was sonicated in a bath sonicator for 20 min. Translation mixes including microsomes were incubated with various amounts of sterol in the form of sterol-CyD complexes during the translation/translocation assay. Sterol-CyD complexes were added to the translation mix together with mRNA and microsomes at the beginning of the incubation, unless otherwise stated. Microsomes were extracted with hexane/2-propanol (3/2, v/v) and water, and again with hexane, to obtain the total lipids. The organic phase was then collected and evaporated to dryness. The extracted lipids were applied on a high performance thin layer chromatography plate and eluted with chloroform:methanol:water (25:10:1.1 by volume) to separate the phospholipid classes. The phospholipids were visualized by staining with cupric acetate (3%, w/v and 8% H3PO4, w/v) and heating the plates for 15 min at 150 °C to develop the color and identified from standards run in parallel. The absorbance of the lipid spots was determined with a scanning densitometer (Camag TLC Scanner 3). The amount of sphingomyelin in the microsomal preparation was calculated from the absorbance data compared with a sphingomyelin standard series. The amount of cholesterol in the microsomal membranes was analyzed from the total lipid extract by gas-liquid chromatography (Shimadzu GC-14A). Epicoprostanol was added as an internal standard to the samples. The cholesterol amount in the sample was calculated compared with a standard sample with known cholesterol concentration. The samples were injected on a SacTM-5 column (0.25-μm film, 0.25 mm × 30 m, Supelco) with the inlet block at 260 °C and separated on the column with a temperature program of 6 °C·min−1 from 260 to 280 °C. The samples were detected with a flame ionization detector at 300 °C. The amount of sphingomyelin and cholesterol in the microsomal preparation was calculated relative to the protein concentration in the microsomes. The protein concentration in the sample was determined by the method of Lowry (33Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar), using bovine serum albumin as standard. The cholesterol measurements were done by an ACAT assay as described in Ref. 18Lange Y. Steck T.L. J. Biol. Chem. 1997; 272: 13103-13108Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar. In vitro translations were done in reticulocyte lysate in the presence of rough microsomes and cholesterol-CyD complexes or unloaded CyD. After translation the microsomes were sedimented in a Beckman tabletop centrifuge (4 °C, 70 K, 10 min, 100.3 rotor). The pellet was resuspended in MS buffer containing dithiothreitol (1 mm), bovine serum albumin (1 mg/ml), and [14C]oleoyl-coenzyme A (30 μm) and incubated at 37 °C for 60 min to allow ACAT to esterify cholesterol residing in the ER fraction. After incubation, microsomes were sedimented, the enzyme was inactivated, and cholesterol esters were measured. Briefly, microsomal lipids were extracted with hexane/2-propanol (3/2 v/v), the solvent was evaporated, and the lipids were re-dissolved in hexane/2-propanol. The lipid samples were applied on normal phase thin layer chromatography plates and separated with hexane/diethyl ether/acetic acid (130/30/2 v/v/v). Lipid spots were visualized by staining with iodine and identified from standards run in parallel. The cholesterol ester spots were cut into scintillation vials and counted for radioactivity with a LKB Rack-Beta liquid scintillation counter. To study the effect of cholesterol on protein translocation across the ER membrane, rough dog pancreas microsomes were incubated with different amounts of methyl-β-cyclodextrin (CyD)-bound cholesterol in an in vitro protein translocation assay. As shown in Fig. 1,N-glycosylation of the C-terminal P2 domain of the model membrane protein leader peptidase (Lep, panel A) was completely blocked by 0.10 μg/μl cholesterol (panel B). Addition of cyclodextrin (Cyd) alone had no effect (panel B, lane 3). To ascertain that the inhibition of glycosylation was caused by an inhibition of translocation rather than an effect on the oligosaccharyltransferase, microsomes were subjected to alkaline extraction to assay for membrane integration of Lep (Fig. 1,panel C). In the absence of cholesterol, essentially all glycosylated molecules remained in the alkali-resistant membrane pellet (P), whereas most of the molecules were found in the supernatant (S) when translation was carried out in the presence of cholesterol. Finally, translocation of Lep was also assayed by signal peptide cleavage. For this, a construct with a signal peptidase cleavage site at the C-terminal end of an engineered H2 segment was used (the H2 sequence was … KKKKL14VPSAQA+A … where the “+” sign indicates the signal peptidase cleavage site; see Ref. 34Nilsson I. Whitley P. von Heijne G. J. Cell Biol. 1994; 126: 1127-1132Crossref PubMed Scopus (124) Google Scholar) (Fig. 2, panel A). Again, translocation was completely inhibited in microsomes that were exposed to 0.10 μg/μl cholesterol (panel B). The reversibility of the cholesterol-dependent inhibition of translocation was tested by first preincubating microsomes at 30 °C for 20 min with an inhibiting concentration of cholesterol (0.10 μg/μl) followed by a second preincubation for 20 min with an excess of uncomplexed cyclodextrin to extract cholesterol back from the microsomal membranes. The treated microsomes (including the added CyD and cholesterol) were then used in a normal in vitro protein translocation assay. As shown in Fig. 3, a concentration of 5.2 μg/μl uncomplexed cyclodextrin in the second preincubation was sufficient to restore the translocation activity, showing that the inhibiting effect of cholesterol is reversible. To better define the step at which cholesterol exerts its inhibiting effect, we used Lep mRNA truncated at codon 271 (56 residues downstream of the glycosylation site) to produce nonglycosylated, translocon-bound RNCs, and then checked whether addition of cholesterol could still block full translocation (as assayed by glycosylation) after release of the nascent chain by treatment with puromycin and high salt (35Whitley P. Nilsson I.M. von Heijne G. J. Biol. Chem. 1996; 271: 6241-6244Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). As shown in Fig. 4, released nascent chains became glycosylated both in the absence (lane 5) and presence (lane 7) of cholesterol, albeit somewhat less efficiently in the latter case. It is unlikely that the cholesterol did not have time to equilibrate between the CyD-bound form and the microsomal membranes during the 10-min incubation preceding the addition of puromycin/high salt, since translocation of full-length Lep is efficiently blocked even when cholesterol is added together with Lep mRNA to the translation/translocation mix (Fig. 1). Since translation was carried out at 22 °C in this experiment rather than at 30 °C as is the experiments using full-length Lep mRNA, we also ascertained that translocation of full-length Lep was completely blocked when the same concentration of CyD-cholesterol as used with the truncated chains (0.23 μg/μl cholesterol) was included in the standard in vitro translation reaction at 22 °C (data not shown). We conclude that cholesterol has at best a marginal effect on translocation through the Sec61 translocon per se and thus that the main inhibition must be at an earlier step in the translocation pathway. Since the microsomal preparations used also contain varying levels of contaminating membranes (the sphingomyelin and unesterified cholesterol levels in the preparation were, respectively, 1.4 ± 0.05 nmol and 1.8 ± 0.05 nmol per mg of protein, suggesting some contamination by plasma membranes, endosomal membranes, and possibly by some Golgi membranes), the cholesterol levels in the ER-derived microsomes cannot be assessed by simply measuring overall cholesterol in the membrane fraction. Instead, an assay originally developed by Lange and Steck was used (18Lange Y. Steck T.L. J. Biol. Chem. 1997; 272: 13103-13108Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), in which ER cholesterol is specifically esterified by the ER enzyme ACAT. Cholesterol levels were measured both in nontreated microsomes and in microsomes incubated with 2 μg of CyD-cholesterol and were found to be increased 3.7-fold in the treated sample (mean of three experiments; data not shown). Since the typical cholesterol level in the ER is about 0.2% of total cellular unesterified cholesterol (18Lange Y. Steck T.L. J. Biol. Chem. 1997; 272: 13103-13108Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), this suggests that the ER membranes in the treated microsomes contained maximally 0.8% of cellular free cholesterol equivalent. Thus, the amount of cholesterol in the ER membranes in the cholesterol-loaded microsomes is much less than the amount of cholesterol found in the plasma membrane. Depending on the cell type and assay method used, cellular plasma membranes have been reported to contain between 40 and 90% of the total cellular unesterified cholesterol (13Lange Y. Swaisgood M.H. Ramos B.V. Steck T.L. J. Biol. Chem. 1989; 264: 3786-3793Abstract Full Text PDF PubMed Google Scholar, 14Van Meer G. Annu. Rev. Cell Biol. 1989; 5: 247-275Crossref PubMed Scopus (349) Google Scholar, 15Lange Y. J. Lipid Res. 1991; 32: 329-339Abstract Full Text PDF PubMed Google Scholar, 16Liscum L. Munn N.J. Biochim. Biophys. Acta. 1999; 1438: 19-37Crossref PubMed Scopus (291) Google Scholar). Golgi membranes contain an intermediate level of cholesterol as compared with ER and the plasma membrane (36Colbeau A. Nachbaur J. Vignais P.M. Biochim. Biophys. Acta. 1971; 249: 462-492Crossref PubMed Scopus (493) Google Scholar, 37Orci L. Montesano R. Meda P. Malaisse-Lagae F. Brown D. Perrelet A. Vassalli P. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 293-297Crossref PubMed Scopus (195) Google Scholar). Cholesterol is asymmetrically distributed within the Golgi, with greater amounts of cholesterol found in the portion of the Golgi located near the plasma membrane than in the Golgi located near the endoplasmic reticulum (37Orci L. Montesano R. Meda P. Malaisse-Lagae F. Brown D. Perrelet A. Vassalli P. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 293-297Crossref PubMed Scopus (195) Google Scholar). Compilation of published estimates of lipid content in various organelles suggest that whereas the cholesterol/phospholipid molar ratio in ER membranes is 0.08 or less, it is about 0.16 in Golgi membranes (38van Meer G. Trends Cell Biol. 1998; 8: 29-33Abstract Full Text PDF PubMed Scopus (124) Google Scholar). However, these values differ in cells from different tissues (see e.g. Ref. 39Brügger B. Sandhoff R. Wegehingel S. Gorgas K. Malsam J. Helms J.B. Lehmann W.D. Nickel W. Wieland F.T. J. Cell Biol. 2000; 151: 507-518Crossref PubMed Scopus (185) Google Scholar), so a direct comparison is difficult to make. Nevertheless, considering that the cholesterol-loaded microsomes in our preparations contain the equivalent of only ≤1% of the cellular free cholesterol, the cholesterol concentration of ER membranes in the loaded microsomes is most likely lower than the amount of cholesterol found in Golgi membranes. We conclude that cholesterol blocks protein translocation across microsomal membranes at a concentration that is similar to its concentration in the Golgi and significantly lower than in the plasma membrane. To further characterize the cholesterol-dependent inhibition of translocation, we used UV-inducible cross-linking to probe the interaction between RNCs and components of the translocation machinery. RNCs were prepared by translation of truncated mRNAs encoding the first 86 residues of the secretory model protein preprolactin (pPL). Lysyl-tRNAs carrying a modified εANB-lysine residue were added to the translation mix to incorporate the photoreactive εANB-Lys probe in place of lysine at positions 4, 9, 72, and 78 in pPL (Fig.5, panel A). The pPL-86-nascent chain is long enough to be efficiently targeted to the Sec61 translocon in the microsomal membrane, but is too short for signal peptide cleavage to take place (40Crowley K.S. Reinhart G.D. Johnson A.E. Cell. 1993; 73: 1101-1115Abstract Full Text PDF PubMed Scopus (237) Google Scholar, 41Krieg U.C. Johnson A.E. Walter P. J. Cell Biol. 1989; 109: 2033-2043Crossref PubMed Scopus (112) Google Scholar). As shown in Fig. 5, panel B, when translated in the absence of microsomes, pPL-86