Glycosylation Efficiency of Asn-Xaa-Thr Sequons Depends Both on the Distance from the C Terminus and on the Presence of a Downstream Transmembrane Segment

Statistical studies of N-glycosylated proteins have indicated that the frequency of nonglycosylated Asn-Xaa-(Thr/Ser) sequons increases toward the C terminus (Gavel, Y., and von Heijne, G. (1990) Protein Eng. 3, 433–442). Usingin vitro transcription/translation of a truncated model protein in the presence of dog pancreas microsomes, we find that glycosylation efficiency of Asn-Xaa-Thr sequons indeed is reduced when the sequon is within ∼60 residues of the C terminus. Surprisingly, the presence of a hydrophobic stop transfer sequence between the Asn-Xaa-Thr sequon and the C terminus results in a very different dependence of glycosylation efficiency on the distance to the C terminus, where the presence of the stop transfer segment inside the ribosome appears to cause a drastic drop in the level of glycosylation. We speculate that this may reflect a change in the structure of the ribosome/translocon complex induced by the stop transfer segment. Statistical studies of N-glycosylated proteins have indicated that the frequency of nonglycosylated Asn-Xaa-(Thr/Ser) sequons increases toward the C terminus (Gavel, Y., and von Heijne, G. (1990) Protein Eng. 3, 433–442). Usingin vitro transcription/translation of a truncated model protein in the presence of dog pancreas microsomes, we find that glycosylation efficiency of Asn-Xaa-Thr sequons indeed is reduced when the sequon is within ∼60 residues of the C terminus. Surprisingly, the presence of a hydrophobic stop transfer sequence between the Asn-Xaa-Thr sequon and the C terminus results in a very different dependence of glycosylation efficiency on the distance to the C terminus, where the presence of the stop transfer segment inside the ribosome appears to cause a drastic drop in the level of glycosylation. We speculate that this may reflect a change in the structure of the ribosome/translocon complex induced by the stop transfer segment. endoplasmic reticulum oligosaccharyl transferase stop transfer polymerase chain reaction In mammalian cells, nascent secretory and membrane proteins are co-translationally glycosylated on Asn-Xaa-(Thr/Ser) sequons by the endoplasmic reticulum (ER)1enzyme oligosaccharyl transferase (OST) (1.Shakin-Eshleman S. Trends Glycosci. Glycotechnol. 1996; 8: 115-120Crossref Scopus (8) Google Scholar). The OST complex is associated with the Sec61 translocon, through which proteins are translocated into the lumen of the ER or inserted into the ER membrane (2.Rapoport T.A. Jungnickel B. Kutay U. Annu. Rev. Biochem. 1996; 65: 271-303Crossref PubMed Scopus (491) Google Scholar). A highly regulated mechanism has been observed during synthesis of transmembrane proteins, where the emergence of a hydrophobic stop transfer (ST) sequence inside the ribosome triggers the closing of the lumenal end of the translocon pore and the almost simultaneous opening of the cytosolic ribosome/translocon seal (3.Liao S. Lin J. Do H. Johnson A. Cell. 1997; 90: 31-41Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar, 4.Hamman B.D. Hendershot L.M. Johnson A.E. Cell. 1998; 92: 747-758Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar). Structural changes on both sides of the translocon are thus effected by the ST sequence from inside the ribosome, but whether these changes are also transmitted to the OST or otherwise influence the glycosylation reaction is unknown. Previously, we have found that the lumenally oriented active site of the OST is positioned at a well defined distance from the surface of the ER membrane (5.Nilsson I. von Heijne G. J. Biol. Chem. 1993; 268: 5798-5801Abstract Full Text PDF PubMed Google Scholar) and can be used as a fixed point of reference to study structural changes in transmembrane segments in the ER membrane (6.Nilsson I. Sääf A. Whitley P. Gafvelin G. Waller C. von Heijne G. J. Mol. Biol. 1998; 284: 1165-1175Crossref PubMed Scopus (114) Google Scholar, 7.Monné M. Nilsson I. Johansson M. Elmhed N. von Heijne G. J. Mol. Biol. 1998; 284: 1177-1183Crossref PubMed Scopus (96) Google Scholar). Here, we have measured the efficiency ofN-glycosylation of Asn-Xaa-Thr sequons as a function of their distance from the C-terminal end of a model protein, in both the absence and the presence of an intervening hydrophobic ST sequence. When there is no ST sequence between the glycosylation acceptor sequon and the C terminus, the glycosylation efficiency increases as the stop codon is moved further away from the sequon and plateaus at a distance of ∼60 residues or more. In stark contrast, with poly-Leu ST sequences of either 15 or 30 hydrophobic residues placed between the acceptor sequon and the C terminus, we observe a dramatic drop in glycosylation efficiency when the C-terminal end of the protein is located immediately downstream of the transmembrane segment. This effect persists until the N-terminal end of the ST sequence is 40–50 residues away from the C-terminal residue, suggesting that the presence of a hydrophobic stretch inside the ribosome when translation terminates somehow prevents access to the OST of a glycosylation acceptor site located immediately upstream of the hydrophobic segment. We speculate that this finding may be related to the previously observed closing of the lumenal end of the translocation channel induced by the appearance of a hydrophobic segment inside the ribosome (3.Liao S. Lin J. Do H. Johnson A. Cell. 1997; 90: 31-41Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar). Unless otherwise stated, all enzymes as well as plasmid pGEM1, RiboMAX SP6 RNA polymerase system, and rabbit reticulocyte lysate were from Promega (Madison, WI). Taqpolymerase, T7 DNA polymerase, [35S]Met,14C-methylated protein standards, deoxyribonucleotides, dideoxyribonucleotides, and the cap analog m7G(5′)ppp(5′)G were from Amersham Pharmacia Biotech. The glycosylation acceptor peptideN-benzoyl-Asn-Leu-Thr-N-methylamide was from Quality Controlled Biochemicals (Hopkinton, MA). The signal peptidase inhibitorN-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethylketone was obtained from Sigma. Oligonucleotides were purchased from Kebo Lab (Stockholm, Sweden) and from Eurosequence (Groningen, the Netherlands). The PCR purification kit and RNeasy RNA clean up were from Qiagen (Hilden, Germany). Oligonucleotides were from Cybergene (Stockholm, Sweden). Insertion of the stop transfer sequences QQQL14VKKKK and QQQL29VKKKK into the P2 domain of Lep was performed by introducing BclI and NdeI restriction sites in codon 214 and 220, respectively. Double-stranded oligonucleotides coding for the above amino acid sequences were then cloned between the BclI and NdeI restriction sites. Site-specific mutagenesis of the lepB gene used to make a Asn214 → Gln mutation (to remove a potential glycosylation acceptor site), to introduce new Asn-Ser-Thr glycosylation acceptor sites, and to introduce restriction enzyme cleavage sites was performed in phage M13 according to the method of Kunkel (8.Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Crossref PubMed Scopus (4881) Google Scholar, 9.Geisselsoder J. Witney F. Yuckenberg P. BioTechniques. 1987; 5: 786-791Google Scholar). The Lep-ST29L(CC/50) construct was made by first cloning a PCR-amplified fragment from the P2 domain of Lep into the Lep-ST29L construct to obtain Lep-ST29L (50). The 5′ primer used in the amplification of the Lep fragment had a EcoRV site in codon 150, and the 3′ primer had a BssHII site in codon 213 in thelepB gene. The amplified EcoRV-BssHII fragment was cloned into the Lep-ST29L construct between the naturalEcoRV and BssHII restriction sites in codons 130 and 145 in the P2 domain. The resulting fusion had the sequence … RGDI130L150P. . . . . PK213K145RAVGL … (numbers refer to the wild type Lep sequence), increasing the size of the P2 domain by 50 residues. In a second step, the Lep-ST29L(CC/50) construct was made by ligating PCR-amplified fragments from a previously constructed Lep-derivative with a signal peptidase cleavage cassette inserted at the C-terminal end of a H2 transmembrane segment composed of 14 leucine residues (10.Nilsson I. Whitley P. von Heijne G. J. Cell Biol. 1994; 126: 1127-1132Crossref PubMed Scopus (124) Google Scholar) and from the Lep-ST29L (50) construct. The 5′ primer used for amplification of the cleavage cassette containing Lep fragment was situated 210 bases upstream of the translational start site, and the 3′ primer had a BglII site in codon 84 in the lepBgene. The 5′ primer used in the amplification of the Lep-ST29L (50) fragment had a BglII site in codon 88 in the lepBgene. The newly created fusion joint had the amino acid sequence … PFQI86SS88 … (numbers refer to the wild type Lep sequence). The amplified fragments were ligated in the gel after agarose gel purification, and mRNA templates were prepared by PCR amplification of the ligated fragments using 5′ and 3′ primers as described below. For cloning into and in vitro expression from the pGEM1 plasmid, the 5′ end of the lepB gene was modified first by the introduction of a XbaI site and second by changing the context 5′ to the initiator ATG codon to a "Kozak consensus" sequence (11.Kozak M. Mol. Cell. Biol. 1989; 9: 5134-5142Crossref PubMed Scopus (482) Google Scholar). Thus, the 5′ region of the gene was modified to: …ATAACCCTCTAGAGCCACCATGGCGAAT … (XbaI site and initiator codon underlined). Mutants of Lep made in phage M13 were cloned into pGEM1 behind the SP6 promoter as aXbaI-SmaI fragment. All mutants were confirmed by DNA sequencing of plasmid and single-stranded M13 DNA using T7 DNA polymerase. Templates for in vitro transcription of truncated mRNA with a 3′ stop codon were prepared using PCR to amplify fragments from pGEM1 plasmids containing the relevant Lep constructs. The 5′ primer was the same for all PCR reactions and had the sequence 5′-TTCGTCCAACCAAACCGACTC-3′. This primer is situated 210 bases upstream of the translational start, and all amplified fragments contained the SP6 transcriptional promoter from pGEM1. The 3′ primers were designed according to the desired positions of the stop codons. All 3′ primers contained the tandem translational stop codons TAG TAA and were designed to have approximately the same annealing temperature as the 5′ primer. PCR amplification was performed with a total of 30 cycles using an annealing temperature of 52 °C. The amplified DNA products were purified using the Qiagen PCR purification kit as described in the manufacturer's protocol and verified on a 1.2% agarose gel. Truncated mRNAs with stop codons were transcribed from the SP6 promoter using the RiboMAX SP6 RNA polymerase system. Transcriptions were carried out at 30 °C for 12 h. The mRNAs were purified using Qiagen RNeasy clean up kit and verified on a 1.2% agarose gel. Translation in reticulocyte lysate in the presence of dog pancreas microsomes was performed as described in Ref. 12.Liljeström P. Garoff H. J. Virol. 1991; 65: 147-154Crossref PubMed Google Scholar, and alkaline extraction was performed as described in Ref. 13.Mothes W. Heinrich S. Graf R. Nilsson I. von Heijne G. Brunner J. Rapoport T. Cell. 1997; 89: 523-533Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar. Proteins were analyzed by SDS-polyacrylamide gel electrophoresis, and gels were quantitated on a Fuji BAS1000 phosphoimager using the MacBAS 2.31 software. The extent of glycosylation of a given mutant was calculated as the quotient between the intensity of the glycosylated band divided by the summed intensities of the glycosylated and nonglycosylated bands. For some constructs, the assay was repeated in the presence of a glycosylation acceptor tripeptide as described (5.Nilsson I. von Heijne G. J. Biol. Chem. 1993; 268: 5798-5801Abstract Full Text PDF PubMed Google Scholar) or in the presence of a signal peptidase inhibitor (14.van Geest M. Nilsson I. von Heijne G. Lolkema J.S. J. Biol. Chem. 1999; 274: 2816-2823Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). We used the well characterized Escherichia coli inner membrane protein leader peptidase (Lep) (Fig.1 A) to measure the glycosylation efficiency of Asn-Xaa-Thr sequons in C-terminally truncated proteins. When Lep is expressed in vitro in the presence of dog pancreas microsomes, both the N-terminal tail and C-terminal P2 domain are translocated to the lumenal side, the same orientation as in E. coli (5.Nilsson I. von Heijne G. J. Biol. Chem. 1993; 268: 5798-5801Abstract Full Text PDF PubMed Google Scholar). A cryptic glycosylation site in the P2 domain, Asn214-Glu-Thr, is efficiently glycosylated upon translocation into the lumen. To measure glycosylation efficiency as a function of the position of the glycosylation acceptor site relative to the C terminus, proteins truncated at various positions in the P2 domain, C-terminal to the naturally occurring, unique Asn214-Glu-Thr sequon and to two engineered unique glycosylation acceptor sites (Asn201-Ser-Thr, Asn203-Ser-Thr), were generated by PCR (Fig. 1 B) using primers encoding tandem stop codons and made by in vitro transcription/translation in reticulocyte lysate in the absence and presence of dog pancreas microsomes. In addition, unique Asn-Ser-Thr acceptor sequons were placed in different positions relative to the C terminus in a variant of the full-length Lep protein where the Asn214 sequon had been removed by an Asn214 → Gln change. As shown in Fig. 2, although there is some variation depending on the exact location of the stop codon, the glycosylation efficiency is reduced by more than 50% when the glycosylation acceptor site is very close to the C terminus, and the efficiency increases gradually with the distance between the acceptor site and the C terminus. Full glycosylation, which is 70–80% in this system (5.Nilsson I. von Heijne G. J. Biol. Chem. 1993; 268: 5798-5801Abstract Full Text PDF PubMed Google Scholar), is observed when the distance between the acceptor site and the C terminus is ∼60 residues or more. For efficient modification, it thus appears that the acceptor site has to reach or at least be close to the OST active site, which is ∼65 residues away from the ribosomal P-site (15.Whitley P. Nilsson I.M. von Heijne G. J. Biol. Chem. 1996; 271: 6241-6244Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar), before chain termination. These results are consistent with an earlier study of the rabies virus glycoprotein, where a reduced glycosylation efficiency of two mutants truncated, respectively, 27 and 69 residues downstream of an acceptor Asn was noted (16.Shakin-Eshleman S.H. Wunner W.H. Spitalnik S.L. Biochemistry. 1993; 32: 9465-9472Crossref PubMed Scopus (40) Google Scholar). Because the results reported above indicated that glycosylation efficiency depends on the location of the acceptor site relative to the OST active site at the time of chain termination, we considered the possibility that glycosylation efficiency may also be influenced by the presence of a hydrophobic ST sequence between the acceptor site and the C terminus. We thus constructed C-terminally truncated versions of two previously studied model proteins (Lep-ST14L and Lep-ST29L) (6.Nilsson I. Sääf A. Whitley P. Gafvelin G. Waller C. von Heijne G. J. Mol. Biol. 1998; 284: 1165-1175Crossref PubMed Scopus (114) Google Scholar) (Fig.3 A) that contain an engineered glycosylation site (Asn201-Ser-Thr or Asn203-Ser-Thr) 16 or 18 residues upstream of a poly-Leu ST sequence composed of either 15 or 30 hydrophobic residues (QQQL14VKKKK or QQQL29VKKKK). When expressed as full-length proteins, Lep-ST14L and Lep-ST29L are efficiently glycosylated on Asn201 and Asn203, respectively (Fig. 3 B). C-terminal truncations were made by introducing tandem stop codons at different sites downstream of and inside the ST segments, and glycosylation was assayed by in vitrotranscription/translation in the absence and presence of microsomes. As shown in Fig. 3 C, for both constructs the glycosylation efficiency remains at ∼35% until the stop codon is placed ∼10 residues into the hydrophobic stretch and then increases to the level seen without a hydrophobic segment. Strikingly, the glycosylation efficiency drops sharply as soon as the stop codon is placed downstream of the ST segment and remains low until the C terminus of the truncated protein is ∼70 residues away from the glycosylation site. Thus, the glycosylation efficiency appears to depend both on the position of the C terminus relative to the ST sequence and to the glycosylation acceptor site. To determine whether the proteins truncated in or near the ST sequence were retained in the membrane, we tested two additional series of constructs. First, we repeated the above experiments using a Lep-ST29L construct with the glycosylation site placed in position 208, only 11 residues upstream of the ST segment. We have shown previously that a glycosylation acceptor site must be at least 13–15 residues upstream of a membrane-anchored ST segment to be a substrate for OST (5.Nilsson I. von Heijne G. J. Biol. Chem. 1993; 268: 5798-5801Abstract Full Text PDF PubMed Google Scholar, 6.Nilsson I. Sääf A. Whitley P. Gafvelin G. Waller C. von Heijne G. J. Mol. Biol. 1998; 284: 1165-1175Crossref PubMed Scopus (114) Google Scholar), and indeed, no glycosylation was seen for the Lep-ST29L(Asn208-Ser-Thr) construct, Fig.4 (lane 1). Similarly, no glycosylation was seen when this construct was truncated by placing tandem stop codons 1, 5, and 15 positions downstream of the ST29L segment (data not shown) or in a position leaving 15 leucine residues in the ST segment (lane 2). However, when only 10 leucines were left in the ST segment, the glycosylation efficiency increased to 20% (lane 3), and with only 5 leucines left, it increased to 38% (lane 4). In the latter construct, the protein was truncated 16 residues downstream of Asn208, and the glycosylation efficiency was thus similar to what was found for the short Lep constructs lacking an ST segment (Fig. 2). As a second control, we introduced a signal peptidase cleavage cassette (10.Nilsson I. Whitley P. von Heijne G. J. Cell Biol. 1994; 126: 1127-1132Crossref PubMed Scopus (124) Google Scholar) at the C-terminal end of the H2 transmembrane segment (Fig.5 A) and assayed membrane integration of constructs truncated at different positions in the ST segment by alkaline extraction (17.Fujiki Y. Hubbard A.L. Fowler S. Lazarow P.B. J. Cell Biol. 1982; 93: 97-102Crossref PubMed Scopus (1374) Google Scholar). For this, Lep-ST29L with the acceptor site at Asn203 was modified by (i) exchanging H2 for a 14-leucine-long hydrophobic segment ending with a signal peptidase cleavage cassette and (ii) adding an extra 50 residues to the P2 domain. The lengthening of the P2 domain was necessary to avoid that the P2-ST fragment remaining after signal peptidase cleavage overlapped in the gel with nonspecific background bands from the in vitro translation. As seen in Fig. 5 B, the resulting full-length Lep-ST29L(CC/50) construct was cleaved by signal peptidase and glycosylated when expressed in the presence of rough microsomes. Significantly, as seen in Fig. 5 C, a truncated form of Lep-ST29L(CC/50) with stop codons placed one residue downstream of the ST segment was not extracted from the membrane pellet by alkali (bottom panel, lanes 5 and 6), whereas a truncated form with only 5 leucine residues left in the ST segment was extractable (top panel, lanes 5 and6). Both truncated forms were inefficiently glycosylated, as expected from Fig. 3 C, and signal peptidase-mediated cleavage of the constructs was inhibited by the signal peptidase inhibitorN-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethylketone (lane 3). From these two sets of control experiments, we conclude that truncated ST segments retaining ∼15 leucine residues or more are efficiently anchored in the membrane (presumably in a transmembrane disposition), whereas those with ∼10 or fewer leucine residues are largely released into the lumen of the microsomes. Thus, the drop in glycosylation efficiency seen in Fig. 3 for proteins truncated after the ST segment cannot be explained by a lack of proper membrane integration of the ST segment. To rule out that the identity of the codon next to the stop codon had an influence on the results, we made two further controls. First, we changed the valine codon GTT at the end of the ST segment in Lep-ST14L to one (GTG) more frequently used in mammalian mRNAs, and placed a stop codon in the next position. Second, we changed the valine codon to one coding for leucine (CTG), again placing the stop codon in the next position. In neither case did we observe an effect on glycosylation, which remained at ∼60% (data not shown). Finally, to rule out the possibility that the low level of glycosylation seen when the stop codon was placed immediately downstream of the ST sequence was caused by the four flanking lysine residues, we changed the C-terminal sequence … LVKKKKHM(stop) to … LVDPNQHM(stop) for both the ST14L and ST29L constructs; again no change in glycosylation efficiency was seen (data not shown). Statistical studies of the location of glycosylated and nonglycosylated potential acceptor sites in secreted proteins have indicated that the frequency of nonglycosylated Asn-Xaa-(Thr/Ser) sequons increases toward the C-terminal end of glycoproteins (18.Gavel Y. von Heijne G. Protein Eng. 1990; 3: 433-442Crossref PubMed Scopus (626) Google Scholar). We now find a similar trend when we successively increase the number of residues between an acceptor site and the C terminus of truncated Lep constructs (Fig. 2), suggesting that glycosylation is inefficient when chain termination happens before the acceptor site reaches the OST active site. Previous measurements have shown that ∼65 residues in a nascent polypeptide chain are required to span the distance between the ribosomal P-site and the OST active site (15.Whitley P. Nilsson I.M. von Heijne G. J. Biol. Chem. 1996; 271: 6241-6244Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar), and we indeed see fully efficient glycosylation only when ∼60 residues or more separate the glycosylation acceptor site from the C terminus. The rate of chain elongation in vitro is quite slow (∼1 residue/s (19.Garoff H. Huylebroeck D. Robinson A. Tillman U. Liljeström P. J. Cell Biol. 1990; 111: 867-876Crossref PubMed Scopus (43) Google Scholar)), and it is possible that the reduction in glycosylation efficiency seen when chain termination precedes glycosylation is the result of a more rapid translocation of the nascent chain relative to the OST once it has been detached from the ribosome. Although we have not tested the truncated Lep constructs in vivo, the observation that more nonglycosylated Asn-Xaa-(Thr/Ser) sequons are found near the C-terminal end of secreted glycoproteins (18.Gavel Y. von Heijne G. Protein Eng. 1990; 3: 433-442Crossref PubMed Scopus (626) Google Scholar) suggest that also in vivo chain termination can influence glycosylation efficiency. We also note that the reduction in glycosylation efficiency seen when the glycosylation site is close to the C-terminal end of the protein needs to be taken into account when mapping the topology of integral membrane proteins by glycosylation scanning (14.van Geest M. Nilsson I. von Heijne G. Lolkema J.S. J. Biol. Chem. 1999; 274: 2816-2823Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 20.Tam L.Y. Landoltmarticorena C. Reithmeier R.A.F. Biochem. J. 1996; 318: 645-648Crossref PubMed Scopus (12) Google Scholar, 21.Popov M. Tam L.Y. Li J. Reithmeier R.A.F. J. Biol. Chem. 1997; 272: 18325-18332Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 22.Nilsson I. Witt S. Kiefer H. Mingarro I. von Heijne G. J. Biol. Chem. 2000; 275: 6207-6213Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar) and points to the necessity to use sufficiently large C-terminal reporter domains. When a hydrophobic ST sequence is present between the acceptor site and the C terminus, a very different behavior is observed. In particular, for constructs where the C-terminal end of the protein is located in a region immediately downstream of the hydrophobic segment, very low levels of glycosylation are seen (Fig. 3 C), even though the separation between the acceptor site and the C terminus is ∼50 residues or more. The level of glycosylation returns to "normal" only when the C terminus is ∼70 residues or more away from the acceptor site, i.e. at a point where the acceptor site has just emerged in the vicinity of the OST active site when the stop codon is reached (15.Whitley P. Nilsson I.M. von Heijne G. J. Biol. Chem. 1996; 271: 6241-6244Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). The reduction in the glycosylation efficiency thus corresponds to a situation where the ST sequence has been fully polymerized but is still largely inside the ribosome at the time of chain termination. The dramatic effect on glycosylation caused by the ST sequence suggests that the hydrophobic segment may in some way affect the structure of the ribosome-translocon-OST complex from inside the ribosome. Indeed, recent experiments have shown that the translocon pore is gated during membrane protein integration; whereas the translocon pore is normally open toward the lumen and closed by the ribosome on the cytosolic side during chain translocation, this situation is rapidly reversed when an ST sequence appears inside the ribosome (3.Liao S. Lin J. Do H. Johnson A. Cell. 1997; 90: 31-41Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar, 4.Hamman B.D. Hendershot L.M. Johnson A.E. Cell. 1998; 92: 747-758Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar). The conversion to a state open toward the cytosol and closed toward the lumen happens already when 4–9 residues have been polymerized in addition to the ST sequence. Similarly, the drop in glycosylation efficiency seen in Fig.3 C happens when the stop codon is placed only a couple of residues downstream of the hydrophobic stretch, both for ST14L and for ST29L. We thus speculate that the closing of the lumenal end of the translocon induced by the presence of an ST sequence in the ribosome also affects the way in which the nascent chain is exposed to the OST and thus indirectly the efficiency with which glycosylation acceptor sites near the C-terminal end of the nascent chain are modified. We thank M. O. Lively for sharing unpublished data on signal peptidase inhibitors.